{"markup":"\u003C?xml version=\u00221.0\u0022 encoding=\u0022UTF-8\u0022 ?\u003E\n \u003Chtml version=\u0022HTML+RDFa+MathML 1.1\u0022\n xmlns:content=\u0022http:\/\/purl.org\/rss\/1.0\/modules\/content\/\u0022\n xmlns:dc=\u0022http:\/\/purl.org\/dc\/terms\/\u0022\n xmlns:foaf=\u0022http:\/\/xmlns.com\/foaf\/0.1\/\u0022\n xmlns:og=\u0022http:\/\/ogp.me\/ns#\u0022\n xmlns:rdfs=\u0022http:\/\/www.w3.org\/2000\/01\/rdf-schema#\u0022\n xmlns:sioc=\u0022http:\/\/rdfs.org\/sioc\/ns#\u0022\n xmlns:sioct=\u0022http:\/\/rdfs.org\/sioc\/types#\u0022\n xmlns:skos=\u0022http:\/\/www.w3.org\/2004\/02\/skos\/core#\u0022\n xmlns:xsd=\u0022http:\/\/www.w3.org\/2001\/XMLSchema#\u0022\n xmlns:mml=\u0022http:\/\/www.w3.org\/1998\/Math\/MathML\u0022\u003E\n \u003Chead\u003E\u003Cscript type=\u0022text\/javascript\u0022 src=\u0022\/\/cdn.jsdelivr.net\/qtip2\/2.2.1\/jquery.qtip.min.js\u0022\u003E\u003C\/script\u003E\n\u003Cscript type=\u0022text\/javascript\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/sites\/default\/files\/js\/js_-MZHQc7Ran_h4OtcC-HT9BulQMedaos1-NFBhT1razc.js\u0022\u003E\u003C\/script\u003E\n\u003Cscript type=\u0022text\/javascript\u0022\u003E\n\u003C!--\/\/--\u003E\u003C![CDATA[\/\/\u003E\u003C!--\nif(typeof window.MathJax === \u0022undefined\u0022) window.MathJax = { menuSettings: { zoom: \u0022Click\u0022 } };\n\/\/--\u003E\u003C!]]\u003E\n\u003C\/script\u003E\n\u003Cscript type=\u0022text\/javascript\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/sites\/default\/files\/js\/js_gPqjYq7fqdMzw8-29XWQIVoDSWTmZCGy9OqaHppNxuQ.js\u0022\u003E\u003C\/script\u003E\n\u003Cscript type=\u0022text\/javascript\u0022\u003E\n\u003C!--\/\/--\u003E\u003C![CDATA[\/\/\u003E\u003C!--\n(function(i,s,o,g,r,a,m){i[\u0022GoogleAnalyticsObject\u0022]=r;i[r]=i[r]||function(){(i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o),m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m)})(window,document,\u0022script\u0022,\u0022\/\/www.google-analytics.com\/analytics.js\u0022,\u0022ga\u0022);ga(\u0022create\u0022, \u0022UA-23555390-4\u0022, {\u0022cookieDomain\u0022:\u0022auto\u0022});ga(\u0022set\u0022, \u0022anonymizeIp\u0022, true);ga(\u0022set\u0022, \u0022page\u0022, location.pathname + location.search + location.hash);ga(\u0022send\u0022, \u0022pageview\u0022);ga(\u0027create\u0027, \u0027UA-189672-18\u0027, \u0027auto\u0027, {\u0027name\u0027: \u0027hwTracker\u0027});\r\nga(\u0027set\u0027, \u0027anonymizeIp\u0027, true);\nga(\u0027hwTracker.send\u0027, \u0027pageview\u0027);\n\/\/--\u003E\u003C!]]\u003E\n\u003C\/script\u003E\n\u003Cscript type=\u0022text\/javascript\u0022\u003E\n\u003C!--\/\/--\u003E\u003C![CDATA[\/\/\u003E\u003C!--\njQuery.extend(Drupal.settings, {\u0022basePath\u0022:\u0022\\\/\u0022,\u0022pathPrefix\u0022:\u0022\u0022,\u0022highwire\u0022:{\u0022ac\u0022:{\u0022\\\/dmm\\\/13\\\/2\\\/dmm040832.atom\u0022:{\u0022access\u0022:{\u0022full\u0022:true},\u0022pisa_id\u0022:\u0022\u0022,\u0022apath\u0022:\u0022\\\/dmm\\\/13\\\/2\\\/dmm040832.atom\u0022,\u0022jcode\u0022:\u0022dmm\u0022}},\u0022quick_nav\u0022:{\u0022nav_down_icon\u0022:\u0022icon-caret-down\u0022,\u0022nav_up_icon\u0022:\u0022icon-caret-up\u0022,\u0022nav_class\u0022:\u0022mobile-only float-me-right\u0022},\u0022processed\u0022:[\u0022highwire_math\u0022],\u0022markup\u0022:[{\u0022requested\u0022:\u0022long\u0022,\u0022variant\u0022:\u0022full-text\u0022,\u0022view\u0022:\u0022full\u0022,\u0022pisa\u0022:\u0022dmm;13\\\/2\\\/dmm040832\u0022}],\u0022trendmd\u0022:{\u0022trendmd-suggestions\u0022:\u0022{\\u0022element\\u0022:\\u0022#trendmd-suggestions\\u0022,\\u0022track_id\\u0022:\\u0022null\\u0022}\u0022}},\u0022instances\u0022:\u0022{\\u0022highwire_abstract_tooltip\\u0022:{\\u0022content\\u0022:{\\u0022text\\u0022:\\u0022\\u0022},\\u0022style\\u0022:{\\u0022tip\\u0022:{\\u0022width\\u0022:20,\\u0022height\\u0022:20,\\u0022border\\u0022:1,\\u0022offset\\u0022:0,\\u0022corner\\u0022:true},\\u0022classes\\u0022:\\u0022qtip-custom hw-tooltip hw-abstract-tooltip qtip-shadow qtip-rounded\\u0022,\\u0022classes_custom\\u0022:\\u0022hw-tooltip hw-abstract-tooltip\\u0022},\\u0022position\\u0022:{\\u0022at\\u0022:\\u0022right center\\u0022,\\u0022my\\u0022:\\u0022left center\\u0022,\\u0022viewport\\u0022:true,\\u0022adjust\\u0022:{\\u0022method\\u0022:\\u0022shift\\u0022}},\\u0022show\\u0022:{\\u0022event\\u0022:\\u0022mouseenter click \\u0022,\\u0022solo\\u0022:true},\\u0022hide\\u0022:{\\u0022event\\u0022:\\u0022mouseleave \\u0022,\\u0022fixed\\u0022:1,\\u0022delay\\u0022:\\u0022100\\u0022}},\\u0022highwire_author_tooltip\\u0022:{\\u0022content\\u0022:{\\u0022text\\u0022:\\u0022\\u0022},\\u0022style\\u0022:{\\u0022tip\\u0022:{\\u0022width\\u0022:15,\\u0022height\\u0022:15,\\u0022border\\u0022:1,\\u0022offset\\u0022:0,\\u0022corner\\u0022:true},\\u0022classes\\u0022:\\u0022qtip-custom hw-tooltip hw-author-tooltip qtip-shadow qtip-rounded\\u0022,\\u0022classes_custom\\u0022:\\u0022hw-tooltip hw-author-tooltip\\u0022},\\u0022position\\u0022:{\\u0022at\\u0022:\\u0022top center\\u0022,\\u0022my\\u0022:\\u0022bottom center\\u0022,\\u0022viewport\\u0022:true,\\u0022adjust\\u0022:{\\u0022method\\u0022:\\u0022\\u0022}},\\u0022show\\u0022:{\\u0022event\\u0022:\\u0022mouseenter \\u0022,\\u0022solo\\u0022:true},\\u0022hide\\u0022:{\\u0022event\\u0022:\\u0022mouseleave \\u0022,\\u0022fixed\\u0022:1,\\u0022delay\\u0022:\\u0022100\\u0022}},\\u0022highwire_reflinks_tooltip\\u0022:{\\u0022content\\u0022:{\\u0022text\\u0022:\\u0022\\u0022},\\u0022style\\u0022:{\\u0022tip\\u0022:{\\u0022width\\u0022:15,\\u0022height\\u0022:15,\\u0022border\\u0022:1,\\u0022mimic\\u0022:\\u0022top center\\u0022,\\u0022offset\\u0022:0,\\u0022corner\\u0022:true},\\u0022classes\\u0022:\\u0022qtip-custom hw-tooltip hw-ref-link-tooltip qtip-shadow qtip-rounded\\u0022,\\u0022classes_custom\\u0022:\\u0022hw-tooltip hw-ref-link-tooltip\\u0022},\\u0022position\\u0022:{\\u0022at\\u0022:\\u0022bottom left\\u0022,\\u0022my\\u0022:\\u0022top left\\u0022,\\u0022viewport\\u0022:true,\\u0022adjust\\u0022:{\\u0022method\\u0022:\\u0022flip\\u0022}},\\u0022show\\u0022:{\\u0022event\\u0022:\\u0022mouseenter \\u0022,\\u0022solo\\u0022:true},\\u0022hide\\u0022:{\\u0022event\\u0022:\\u0022mouseleave \\u0022,\\u0022fixed\\u0022:1,\\u0022delay\\u0022:\\u0022100\\u0022}}}\u0022,\u0022qtipDebug\u0022:\u0022{\\u0022leaveElement\\u0022:0}\u0022,\u0022googleanalytics\u0022:{\u0022trackOutbound\u0022:1,\u0022trackMailto\u0022:1,\u0022trackDownload\u0022:1,\u0022trackDownloadExtensions\u0022:\u00227z|aac|arc|arj|asf|asx|avi|bin|csv|doc(x|m)?|dot(x|m)?|exe|flv|gif|gz|gzip|hqx|jar|jpe?g|js|mp(2|3|4|e?g)|mov(ie)?|msi|msp|pdf|phps|png|ppt(x|m)?|pot(x|m)?|pps(x|m)?|ppam|sld(x|m)?|thmx|qtm?|ra(m|r)?|sea|sit|tar|tgz|torrent|txt|wav|wma|wmv|wpd|xls(x|m|b)?|xlt(x|m)|xlam|xml|z|zip\u0022,\u0022trackColorbox\u0022:1,\u0022trackUrlFragments\u0022:1},\u0022ajaxPageState\u0022:{\u0022js\u0022:{\u0022\\\/\\\/cdn.jsdelivr.net\\\/qtip2\\\/2.2.1\\\/jquery.qtip.min.js\u0022:1,\u0022sites\\\/all\\\/modules\\\/highwire\\\/highwire\\\/plugins\\\/highwire_markup_process\\\/js\\\/highwire_article_reference_popup.js\u0022:1,\u0022sites\\\/all\\\/modules\\\/highwire\\\/highwire\\\/plugins\\\/highwire_markup_process\\\/js\\\/highwire_quick_nav.js\u0022:1,\u0022sites\\\/all\\\/modules\\\/highwire\\\/highwire\\\/plugins\\\/highwire_markup_process\\\/js\\\/highwire_at_symbol.js\u0022:1,\u00220\u0022:1,\u0022sites\\\/all\\\/modules\\\/contrib\\\/google_analytics\\\/googleanalytics.js\u0022:1,\u00221\u0022:1}}});\n\/\/--\u003E\u003C!]]\u003E\n\u003C\/script\u003E\n\u003Clink type=\u0022text\/css\u0022 rel=\u0022stylesheet\u0022 href=\u0022https:\/\/www.stormoverpacific.com\/sites\/default\/files\/advagg_css\/css__uXgUByez87OKDsgffPHe7u5qNUzr7zOnqWrSJ87THKk__RR-QNYl6SsTObm37M1MaRCUwwzIP19wUZLcqO_pRc1Q__MWGPudBpBmsaTs1FKLLZ0RHlWpbgNx0qxDcFgKr833o.css\u0022 media=\u0022all\u0022 \/\u003E\n\u003Clink type=\u0022text\/css\u0022 rel=\u0022stylesheet\u0022 href=\u0022\/\/cdn.jsdelivr.net\/qtip2\/2.2.1\/jquery.qtip.min.css\u0022 media=\u0022all\u0022 \/\u003E\n\u003Clink type=\u0022text\/css\u0022 rel=\u0022stylesheet\u0022 href=\u0022https:\/\/www.stormoverpacific.com\/sites\/default\/files\/advagg_css\/css__14LtxqLbXLYbBfVMMQ9Q34-c_XuRCLysSbYzec2Yg7c__D54ZwXgdmNjsLbqQVhqLvp5C1q9rkCa4B9zVSvOoNHA__MWGPudBpBmsaTs1FKLLZ0RHlWpbgNx0qxDcFgKr833o.css\u0022 media=\u0022all\u0022 \/\u003E\n\u003Clink rel=\u0027stylesheet\u0027 type=\u0027text\/css\u0027 href=\u0027\/sites\/all\/modules\/contrib\/panels\/plugins\/layouts\/onecol\/onecol.css\u0027 \/\u003E\u003C\/head\u003E\u003Cbody\u003E\u003Cdiv class=\u0022panels-ajax-tab-panel panels-ajax-tab-panel-jnl-template-cob-tab-art\u0022\u003E\u003Cdiv class=\u0022panel-display panel-1col clearfix\u0022 \u003E\n \u003Cdiv class=\u0022panel-panel panel-col\u0022\u003E\n \u003Cdiv\u003E\u003Cdiv class=\u0022panel-pane pane-highwire-markup article-heading\u0022 \u003E\n \n \n \n \u003Cdiv class=\u0022pane-content\u0022\u003E\n \u003Cdiv class=\u0022highwire-markup\u0022\u003E\u003Cdiv xmlns=\u0022http:\/\/www.w3.org\/1999\/xhtml\u0022 id=\u0022content-block-markup\u0022 data-highwire-cite-ref-tooltip-instance=\u0022highwire_reflinks_tooltip\u0022 xmlns:xhtml=\u0022http:\/\/www.w3.org\/1999\/xhtml\u0022\u003E\u003Cdiv class=\u0022article fulltext-view \u0022\u003E\u003Cspan class=\u0022highwire-journal-article-marker-start\u0022\u003E\u003C\/span\u003E\u003Cdiv class=\u0022section abstract\u0022 id=\u0022abstract-1\u0022\u003E\u003Ch2 class=\u0022\u0022\u003EABSTRACT\u003C\/h2\u003E\u003Cp id=\u0022p-3\u0022\u003ELimb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the \u03b3-sarcoglycan (\u003Cem\u003ESGCG\u003C\/em\u003E) gene. The most common \u003Cem\u003ESGCG\u003C\/em\u003E mutation is a single nucleotide deletion from a stretch of five thymine residues in \u003Cem\u003ESGCG\u003C\/em\u003E exon 6 (521\u0394T). This founder mutation disrupts the transcript reading frame, abolishing protein expression. An antisense oligonucleotide exon-skipping method to reframe the human 521\u0394T transcript requires skipping four exons to generate a functional, internally truncated protein. \u003Cem\u003EIn vivo\u003C\/em\u003E evaluation of this multi-exon skipping, antisense-mediated therapy requires a genetically appropriate mouse model. The human and mouse \u03b3-sarcoglycan genes are highly homologous in sequence and gene structure, including the exon 6 region harboring the founder mutation. Herein, we describe a new mouse model of this form of limb-girdle muscular dystrophy generated using CRISPR\/Cas9-mediated gene editing to introduce a single thymine deletion in murine exon 6, recreating the 521\u0394T point mutation in \u003Cem\u003ESgcg\u003C\/em\u003E. These mice express the 521\u0394T transcript, lack \u03b3-sarcoglycan protein and exhibit a severe dystrophic phenotype. Phenotypic characterization demonstrated reduced muscle mass, increased sarcolemmal leak and fragility, and decreased muscle function, consistent with the human pathological findings. Furthermore, we showed that intramuscular administration of a murine-specific multiple exon-directed antisense oligonucleotide cocktail effectively corrected the 521\u0394T reading frame. These data demonstrate a molecularly and pathologically suitable model for \u003Cem\u003Ein vivo\u003C\/em\u003E testing of a multi-exon skipping strategy to advance preclinical development of this genetic correction approach.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv class=\u0022section intro\u0022 id=\u0022sec-1\u0022\u003E\u003Ch2 class=\u0022\u0022\u003EINTRODUCTION\u003C\/h2\u003E\u003Cp id=\u0022p-5\u0022\u003ELimb-girdle muscular dystrophy type 2C (LGMD 2C) is a rare genetic disorder caused by autosomal recessive mutations in the \u03b3-sarcoglycan (\u003Cem\u003ESGCG\u003C\/em\u003E) gene (\u003Ca id=\u0022xref-ref-34-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-34\u0022\u003EMcNally et al., 1996b\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-37-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-37\u0022\u003ENoguchi et al., 1995\u003C\/a\u003E). \u03b3-Sarcoglycan is a dystrophin-associated protein, and loss of function mutations in the \u003Cem\u003ESGCG\u003C\/em\u003E gene produces a clinical picture similar to what is seen in Duchenne muscular dystrophy (DMD) (\u003Ca id=\u0022xref-ref-5-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-5\u0022\u003EBen Jelloun-Dellagi et al., 1990\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-32-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-32\u0022\u003EMatsumura et al., 1992\u003C\/a\u003E). There is currently no effective treatment for this form of LGMD, and clinical care focuses on alleviating symptoms by providing respiratory and cardiac support (\u003Ca id=\u0022xref-ref-43-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-43\u0022\u003EStraub and Bushby, 2008\u003C\/a\u003E).\u003C\/p\u003E\u003Cp id=\u0022p-6\u0022\u003EThe \u003Cem\u003ESGCG\u003C\/em\u003E gene itself is comprised of eight exons and encodes \u03b3-sarcoglycan, a type II transmembrane protein, expressed highly in skeletal and cardiac muscle. \u03b3-Sarcoglycan is an essential component of a large membrane-linked dystrophin-associated protein complex (\u003Ca id=\u0022xref-ref-8-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-8\u0022\u003ECohn and Campbell, 2000\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-15-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-15\u0022\u003EErvasti and Campbell, 1993\u003C\/a\u003E). This complex is required for muscle membrane stability and function, and its disruption results in muscle degeneration and wasting (\u003Ca id=\u0022xref-ref-13-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-13\u0022\u003EDurbeej and Campbell, 2002\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-40-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-40\u0022\u003ERahimov and Kunkel, 2013\u003C\/a\u003E). Mutations that disrupt the dystrophin gene cause DMD, the most common form of muscular dystrophy (\u003Ca id=\u0022xref-ref-25-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-25\u0022\u003EHoffman et al., 1987\u003C\/a\u003E). Recently, the United States Food and Drug Administration (FDA) approved a first-in-class exon-skipping gene therapy to treat the most common dystrophin mutations, directly targeting the underlying genetic cause of disease (\u003Ca id=\u0022xref-ref-1-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-1\u0022\u003EAartsma-Rus and Krieg, 2017\u003C\/a\u003E).\u003C\/p\u003E\u003Cp id=\u0022p-7\u0022\u003EExon skipping relies on chemically modified antisense oligonucleotides (AONs) to modulate gene expression, including correction of an aberrant reading frame which abrogates protein expression (\u003Ca id=\u0022xref-ref-6-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-6\u0022\u003EChan et al., 2006\u003C\/a\u003E). Chemically modified AONs can modulate pre-mRNA splicing, bypassing mutations and generating an internally truncated protein that is able to partially rescue the loss of the full-length protein (\u003Ca id=\u0022xref-ref-29-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-29\u0022\u003EKole et al., 2012\u003C\/a\u003E). In DMD, internally deleted forms of dystrophin are known to be functional and result in a milder form of disease known as Becker muscular dystrophy (BMD) (\u003Ca id=\u0022xref-ref-28-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-28\u0022\u003EKoenig et al., 1989\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-35-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-35\u0022\u003EMonaco et al., 1988\u003C\/a\u003E). The goal of exon skipping to treat DMD is to induce retention of out-of-frame exons and to create an intact reading frame. The development of antisense-mediated splice modulating therapy is expanding beyond DMD to other disorders including Pompe disease, cystic fibrosis, cardiomyopathies and laminopathies (\u003Ca id=\u0022xref-ref-7-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-7\u0022\u003EClayton et al., 2014\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-18-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-18\u0022\u003EGedicke-Hornung et al., 2013\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-20-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-20\u0022\u003EGramlich et al., 2015\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-26-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-26\u0022\u003EIgreja et al., 2016\u003C\/a\u003E).\u003C\/p\u003E\u003Cp id=\u0022p-8\u0022\u003ERecently, we described an exon skipping strategy to treat LGMD 2C (\u003Ca id=\u0022xref-ref-17-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-17\u0022\u003EGao et al., 2015\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-47-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-47\u0022\u003EWyatt et al., 2018\u003C\/a\u003E). The most common mutation resulting in LGMD 2C is a single thymine deletion in \u003Cem\u003ESGCG\u003C\/em\u003E exon 6, designated 521\u0394T (\u003Ca id=\u0022xref-ref-33-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-33\u0022\u003EMcNally et al., 1996a\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-37-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-37\u0022\u003ENoguchi et al., 1995\u003C\/a\u003E). This founder mutation disrupts the reading frame, ablating \u03b3-sarcoglycan protein expression. Reading frame correction requires skipping of exons 4, 5, 6 and 7 to create an internally truncated protein termed Mini-Gamma. Mini-Gamma is encoded by exons 2, 3 and 8 (\u003Ca id=\u0022xref-ref-17-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-17\u0022\u003EGao et al., 2015\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-47-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-47\u0022\u003EWyatt et al., 2018\u003C\/a\u003E). Transgenic overexpression of Mini-Gamma protein in \u003Cem\u003EDrosophila\u003C\/em\u003E and mice lacking \u03b3-sarcoglycan rescued the dystrophic phenotype (\u003Ca id=\u0022xref-ref-17-3\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-17\u0022\u003EGao et al., 2015\u003C\/a\u003E). Furthermore, a multi-exon skipping cocktail was able to correct \u003Cem\u003ESGCG\u003C\/em\u003E mutations in cell lines derived from LGMD 2C patients (\u003Ca id=\u0022xref-ref-47-3\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-47\u0022\u003EWyatt et al., 2018\u003C\/a\u003E).\u003C\/p\u003E\u003Cp id=\u0022p-9\u0022\u003EAlthough these previous studies demonstrate aspects of the feasibility of multi-exon skipping, the lack of preclinical \u003Cem\u003Ein vivo\u003C\/em\u003E testing has been a limitation. A previously generated \u03b3-sarcoglycan-null mouse model resembles findings seen in human patients with sarcolemmal fragility, muscle degeneration and impaired muscle function (\u003Ca id=\u0022xref-ref-21-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-21\u0022\u003EHack et al., 1998\u003C\/a\u003E). However, the mouse models in which the \u03b3-sarcoglycan gene was disrupted lack the exon containing the initiator methionine, and are not amenable to exon skipping (\u003Ca id=\u0022xref-ref-21-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-21\u0022\u003EHack et al., 1998\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-41-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-41\u0022\u003ESasaoka et al., 2003\u003C\/a\u003E). The human and mouse \u03b3-sarcoglycan genes share \u0026gt;80% homology, including the stretch of five thymine residues in exon 6. We used CRISPR\/Cas9 technology with homology-directed repair to introduce the specific 521\u0394T mutation in mice. These mice express the mutant 521\u0394T transcript and lack \u03b3-sarcoglycan expression. Furthermore, they exhibit a severe dystrophic phenotype, which includes muscle degeneration, increased membrane leak and fibrosis, and loss of muscle function. This is a suitable model for preclinical evaluation of multi-exon skipping therapy to treat the majority of people with LGMD 2C.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv class=\u0022section results\u0022 id=\u0022sec-2\u0022\u003E\u003Ch2 class=\u0022\u0022\u003ERESULTS\u003C\/h2\u003E\u003Cdiv id=\u0022sec-3\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EGeneration of 521\u0394T mice\u003C\/h3\u003E\u003Cp id=\u0022p-10\u0022\u003EThe most common \u03b3-sarcoglycan mutation in humans, 521\u0394T, disrupts the \u003Cem\u003ESGCG\u003C\/em\u003E reading frame in exon 6, causing loss of protein expression (\u003Ca id=\u0022xref-fig-1-1\u0022 class=\u0022xref-fig\u0022 href=\u0022#F1\u0022\u003EFig.\u00a01\u003C\/a\u003EA) (\u003Ca id=\u0022xref-ref-33-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-33\u0022\u003EMcNally et al., 1996a\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-37-3\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-37\u0022\u003ENoguchi et al., 1995\u003C\/a\u003E). The mouse \u003Cem\u003ESgcg\u003C\/em\u003E gene is located on chromosome 14 (\u003Ca id=\u0022xref-fig-1-2\u0022 class=\u0022xref-fig\u0022 href=\u0022#F1\u0022\u003EFig.\u00a01\u003C\/a\u003EB), and both the human and mouse \u03b3-sarcoglycan genes share a similar gene structure, with eight exons, sharing more than 80% homology at the genomic and protein levels. This homology extends to the 521\u0394T region of exon 6 (\u003Ca id=\u0022xref-fig-1-3\u0022 class=\u0022xref-fig\u0022 href=\u0022#F1\u0022\u003EFig.\u00a01\u003C\/a\u003EC). The advent of CRISPR\/Cas technology has significantly impacted the ease of generating mouse models of human disease (\u003Ca id=\u0022xref-ref-46-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-46\u0022\u003EWang et al., 2013\u003C\/a\u003E). A single-guide RNA (gRNA) can direct double-strand breaks in the genome. Precise genome edits can be achieved through homology directed repair (HDR) when accompanied by a repair template (\u003Ca id=\u0022xref-ref-10-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-10\u0022\u003ECong et al., 2013\u003C\/a\u003E). We used CRISPR\/Cas9 technology to engineer a new mouse model of LGMD 2C, caused by a single thymine deletion in \u003Cem\u003ESgcg\u003C\/em\u003E exon 6, termed 521\u0394T. The specific design is shown in \u003Ca id=\u0022xref-fig-1-4\u0022 class=\u0022xref-fig\u0022 href=\u0022#F1\u0022\u003EFig.\u00a01\u003C\/a\u003ED.\n\u003C\/p\u003E\u003Cdiv id=\u0022F1\u0022 class=\u0022fig pos-float odd\u0022\u003E\u003Cdiv class=\u0022highwire-figure\u0022\u003E\u003Cdiv class=\u0022fig-inline-img-wrapper\u0022\u003E\u003Cdiv class=\u0022fig-inline-img\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F1.large.jpg?width=800\u0026amp;height=600\u0026amp;carousel=1\u0022 title=\u0022Gene editing to engineer the 521\u0026#x394;T Sgcg point mutation in mice. (A) Schematic of the human SGCG gene on the left and the 521\u0026#x394;T mutation on the right. The 521\u0026#x394;T mutation is the most common LGMD 2C mutation. The single thymine deletion causes a frameshift, the expression of a premature stop codon, and loss of \u0026#x3B3;-sarcoglycan protein expression. (B) Schematic of the genetic locus and composition of the murine Sgcg gene. Both the human and the mouse genes include eight exons, with exons 2-8 encoding protein. Each coding region is 876\u0026#x2005;bp with each individual exon having the same number of coding base pairs. Exon 6 is highlighted in red. (C) Both human and murine exon 6 are 73\u0026#x2005;bp in length, and each has a stretch of five thymines in the same location (highlighted in yellow). Individual base pair mismatches are shown in red. (D) Schematic depicting the CRISPR design strategy to introduce the 521\u0026#x394;T mutation into the mouse genome. A 20\u0026#xA0;nt gRNA sequence (blue line) was used to direct Cas9 nuclease to the specific locus, defined by the presence of a -NGG protospacer adjacent motif (PAM, pink line). The nuclease created a double- strand break 3\u0026#x2005;bp upstream of the PAM (arrowhead). The addition of a 180\u0026#xA0;nt repair template promoted HDR and contained the single base pair deletion (gray lines depict homology arms).\u0022 class=\u0022highwire-fragment fragment-images colorbox-load\u0022 rel=\u0022gallery-fragment-images-857853315\u0022 data-figure-caption=\u0022\u0026lt;div class=\u0026quot;highwire-markup\u0026quot;\u0026gt;\u0026lt;div xmlns=\u0026quot;http:\/\/www.w3.org\/1999\/xhtml\u0026quot;\u0026gt;\u0026lt;strong\u0026gt;Gene editing to engineer the 521\u0026#x394;T \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; point mutation in mice.\u0026lt;\/strong\u0026gt; (A) Schematic of the human \u0026lt;em\u0026gt;SGCG\u0026lt;\/em\u0026gt; gene on the left and the 521\u0026#x394;T mutation on the right. The 521\u0026#x394;T mutation is the most common LGMD 2C mutation. The single thymine deletion causes a frameshift, the expression of a premature stop codon, and loss of \u0026#x3B3;-sarcoglycan protein expression. (B) Schematic of the genetic locus and composition of the murine \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; gene. Both the human and the mouse genes include eight exons, with exons 2-8 encoding protein. Each coding region is 876\u0026#x2005;bp with each individual exon having the same number of coding base pairs. Exon 6 is highlighted in red. (C) Both human and murine exon 6 are 73\u0026#x2005;bp in length, and each has a stretch of five thymines in the same location (highlighted in yellow). Individual base pair mismatches are shown in red. (D) Schematic depicting the CRISPR design strategy to introduce the 521\u0026#x394;T mutation into the mouse genome. A 20\u0026#xA0;nt gRNA sequence (blue line) was used to direct Cas9 nuclease to the specific locus, defined by the presence of a -NGG protospacer adjacent motif (PAM, pink line). The nuclease created a double- strand break 3\u0026#x2005;bp upstream of the PAM (arrowhead). The addition of a 180\u0026#xA0;nt repair template promoted HDR and contained the single base pair deletion (gray lines depict homology arms).\u0026lt;\/div\u0026gt;\u0026lt;\/div\u0026gt;\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003E\u003Cspan class=\u0022hw-responsive-img\u0022\u003E\u003Cimg class=\u0022highwire-fragment fragment-image lazyload\u0022 alt=\u0022Fig. 1.\u0022 src=\u0022data:image\/gif;base64,R0lGODlhAQABAIAAAAAAAP\/\/\/yH5BAEAAAAALAAAAAABAAEAAAIBRAA7\u0022 data-src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F1.medium.gif\u0022 width=\u0022440\u0022 height=\u0022375\u0022\/\u003E\u003Cnoscript\u003E\u003Cimg class=\u0022highwire-fragment fragment-image\u0022 alt=\u0022Fig. 1.\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F1.medium.gif\u0022 width=\u0022440\u0022 height=\u0022375\u0022\/\u003E\u003C\/noscript\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cul class=\u0022highwire-figure-links inline\u0022\u003E\u003Cli class=\u0022download-fig first\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F1.large.jpg?download=true\u0022 class=\u0022highwire-figure-link highwire-figure-link-download\u0022 title=\u0022Download Fig. 1.\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload figure\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022new-tab\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F1.large.jpg\u0022 class=\u0022highwire-figure-link highwire-figure-link-newtab\u0022 target=\u0022_blank\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EOpen in new tab\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339098\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cdiv class=\u0022fig-caption\u0022 xmlns:xhtml=\u0022http:\/\/www.w3.org\/1999\/xhtml\u0022\u003E\u003Cspan class=\u0022fig-label\u0022\u003EFig. 1.\u003C\/span\u003E \u003Cp id=\u0022p-11\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003EGene editing to engineer the 521\u0394T \u003Cem\u003ESgcg\u003C\/em\u003E point mutation in mice.\u003C\/strong\u003E (A) Schematic of the human \u003Cem\u003ESGCG\u003C\/em\u003E gene on the left and the 521\u0394T mutation on the right. The 521\u0394T mutation is the most common LGMD 2C mutation. The single thymine deletion causes a frameshift, the expression of a premature stop codon, and loss of \u03b3-sarcoglycan protein expression. (B) Schematic of the genetic locus and composition of the murine \u003Cem\u003ESgcg\u003C\/em\u003E gene. Both the human and the mouse genes include eight exons, with exons 2-8 encoding protein. Each coding region is 876\u2005bp with each individual exon having the same number of coding base pairs. Exon 6 is highlighted in red. (C) Both human and murine exon 6 are 73\u2005bp in length, and each has a stretch of five thymines in the same location (highlighted in yellow). Individual base pair mismatches are shown in red. (D) Schematic depicting the CRISPR design strategy to introduce the 521\u0394T mutation into the mouse genome. A 20\u00a0nt gRNA sequence (blue line) was used to direct Cas9 nuclease to the specific locus, defined by the presence of a -NGG protospacer adjacent motif (PAM, pink line). The nuclease created a double- strand break 3\u2005bp upstream of the PAM (arrowhead). The addition of a 180\u00a0nt repair template promoted HDR and contained the single base pair deletion (gray lines depict homology arms).\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cp id=\u0022p-12\u0022\u003ECRISPR reagents were microinjected into zygotes derived from C57BL\/6J mice, and introduced into pseudo-pregnant females. Of 13 potential founders, a single mouse harbored a heterozygous 521\u0394T mutation in the \u003Cem\u003ESgcg\u003C\/em\u003E locus, with the other allele remaining unedited [wild type (WT)]. This F0 mouse was crossed with a WT C57BL\/6J mouse (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S1\u003C\/a\u003E). Heterozygous offspring were then backcrossed for five generations onto the DBA\/2J background. The DBA\/2J genetic background strain has previously been reported to modify the dystrophic phenotype, resulting in a more severe disease progression owing to polymorphisms in modifier genes, including an in-frame deletion in the latent TGF\u03b2-binding protein 4 (\u003Cem\u003ELtbp4\u003C\/em\u003E) gene, which is not present in the C57 background (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S1\u003C\/a\u003E) (\u003Ca id=\u0022xref-ref-9-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-9\u0022\u003EColey et al., 2016\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-24-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-24\u0022\u003EHeydemann et al., 2009\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-44-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-44\u0022\u003ESwaggart et al., 2014\u003C\/a\u003E). The 521\u0394T mice from the F5 generation were genotyped for the deleterious \u003Cem\u003ELtbp4\u003C\/em\u003E allele and were homozygous for the severe \u003Cem\u003ELtbp4\u003C\/em\u003E allele (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S1\u003C\/a\u003E). Homozygous 521\u0394T mice were born in the expected ratio (at 28% versus the expected 25%) (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S1\u003C\/a\u003E).\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-4\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003ESgcg expression in 521\u0394T muscle\u003C\/h3\u003E\u003Cp id=\u0022p-13\u0022\u003ETo validate that the deletion of the single thymine in exon 6 resulted in loss of \u03b3-sarcoglycan, we evaluated gene and protein expression. RT-PCR analysis documented a reduction in \u003Cem\u003ESgcg\u003C\/em\u003E transcript in 521\u0394T muscle, compared with WT. An additional smaller transcript was seen at 590\u2005bp, and this shorter transcript represents endogenous skipping of exon 7 in 521\u0394T muscle (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S2\u003C\/a\u003E), similar to previous reports in human cell lines (\u003Ca id=\u0022xref-ref-47-4\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-47\u0022\u003EWyatt et al., 2018\u003C\/a\u003E). Sequence analysis of RT-PCR products showed deletion of a single thymine in the 5\u2005T region of exon 6 in the \u003Cem\u003E521\u003C\/em\u003E\u0394\u003Cem\u003ET\u003C\/em\u003E transcript (\u003Ca id=\u0022xref-fig-2-1\u0022 class=\u0022xref-fig\u0022 href=\u0022#F2\u0022\u003EFig.\u00a02\u003C\/a\u003EA,B). The deletion results in a premature stop codon and this resulted in absence of \u03b3-sarcoglycan protein (\u003Ca id=\u0022xref-fig-2-2\u0022 class=\u0022xref-fig\u0022 href=\u0022#F2\u0022\u003EFig.\u00a02\u003C\/a\u003EC,D). We examined expression of \u03b3-sarcoglycan in muscle using immunofluorescence microscopy and confirmed loss of \u03b3-sarcoglycan from its normal position at the plasma membrane (\u003Ca id=\u0022xref-fig-2-3\u0022 class=\u0022xref-fig\u0022 href=\u0022#F2\u0022\u003EFig.\u00a02\u003C\/a\u003EC). Loss of \u03b3-sarcoglycan was also observed by immunoblot analysis (\u003Ca id=\u0022xref-fig-2-4\u0022 class=\u0022xref-fig\u0022 href=\u0022#F2\u0022\u003EFig.\u00a02\u003C\/a\u003ED). These data demonstrate that a single thymine deletion in exon 6 results in loss of \u03b3-sarcoglycan protein, identical to that seen in human LGMD 2C patients.\n\u003C\/p\u003E\u003Cdiv id=\u0022F2\u0022 class=\u0022fig pos-float odd\u0022\u003E\u003Cdiv class=\u0022highwire-figure\u0022\u003E\u003Cdiv class=\u0022fig-inline-img-wrapper\u0022\u003E\u003Cdiv class=\u0022fig-inline-img\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F2.large.jpg?width=800\u0026amp;height=600\u0026amp;carousel=1\u0022 title=\u0022Reduction of Sgcg transcript and loss of \u0026#x3B3;-sarcoglycan protein expression in Sgcg 521\u0026#x394;T muscle. (A) RT-PCR illustrating the presence of Sgcg (715\u0026#x2005;bp) and Sgcg 521\u0026#x394;T (714\u0026#x2005;bp) transcripts. (B) Sequence chromatograms of the 5T region in the Sgcg and Sgcg 521\u0026#x394;T transcripts illustrating the deletion of one thymine in exon 6 (red box) of the Sgcg 521\u0026#x394;T transcript. (C) \u0026#x3B3;-Sarcoglycan protein (red) was readily detected in WT muscle, but not in 521\u0026#x394;T muscle. Hoechst (blue) marked nuclei. (D) Immunoblot analysis revealed the presence of \u0026#x3B3;-sarcoglycan protein in WT muscle lysates, whereas \u0026#x3B3;-sarcoglycan was not detected in 521\u0026#x394;T muscle lysates. Data are mean\u0026#xB1;s.e.m. *P\u0022 class=\u0022highwire-fragment fragment-images colorbox-load\u0022 rel=\u0022gallery-fragment-images-857853315\u0022 data-figure-caption=\u0022\u0026lt;div class=\u0026quot;highwire-markup\u0026quot;\u0026gt;\u0026lt;div xmlns=\u0026quot;http:\/\/www.w3.org\/1999\/xhtml\u0026quot;\u0026gt;\u0026lt;strong\u0026gt;Reduction of \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; transcript and loss of \u0026#x3B3;-sarcoglycan protein expression in \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T muscle.\u0026lt;\/strong\u0026gt; (A) RT-PCR illustrating the presence of \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; (715\u0026#x2005;bp) and \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T (714\u0026#x2005;bp) transcripts. (B) Sequence chromatograms of the 5T region in the \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; and \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T transcripts illustrating the deletion of one thymine in exon 6 (red box) of the \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T transcript. (C) \u0026#x3B3;-Sarcoglycan protein (red) was readily detected in WT muscle, but not in 521\u0026#x394;T muscle. Hoechst (blue) marked nuclei. (D) Immunoblot analysis revealed the presence of \u0026#x3B3;-sarcoglycan protein in WT muscle lysates, whereas \u0026#x3B3;-sarcoglycan was not detected in 521\u0026#x394;T muscle lysates. Data are mean\u0026#xB1;s.e.m. *\u0026lt;em\u0026gt;P\u0026lt;\/em\u0026gt;\u0026lt;0.05 (\u0026lt;em\u0026gt;t\u0026lt;\/em\u0026gt;-test). Scale bars: 50\u0026#x2005;\u0026#xB5;m.\u0026lt;\/div\u0026gt;\u0026lt;\/div\u0026gt;\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003E\u003Cspan class=\u0022hw-responsive-img\u0022\u003E\u003Cimg class=\u0022highwire-fragment fragment-image lazyload\u0022 alt=\u0022Fig. 2.\u0022 src=\u0022data:image\/gif;base64,R0lGODlhAQABAIAAAAAAAP\/\/\/yH5BAEAAAAALAAAAAABAAEAAAIBRAA7\u0022 data-src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F2.medium.gif\u0022 width=\u0022440\u0022 height=\u0022299\u0022\/\u003E\u003Cnoscript\u003E\u003Cimg class=\u0022highwire-fragment fragment-image\u0022 alt=\u0022Fig. 2.\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F2.medium.gif\u0022 width=\u0022440\u0022 height=\u0022299\u0022\/\u003E\u003C\/noscript\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cul class=\u0022highwire-figure-links inline\u0022\u003E\u003Cli class=\u0022download-fig first\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F2.large.jpg?download=true\u0022 class=\u0022highwire-figure-link highwire-figure-link-download\u0022 title=\u0022Download Fig. 2.\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload figure\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022new-tab\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F2.large.jpg\u0022 class=\u0022highwire-figure-link highwire-figure-link-newtab\u0022 target=\u0022_blank\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EOpen in new tab\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339099\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cdiv class=\u0022fig-caption\u0022\u003E\u003Cspan class=\u0022fig-label\u0022\u003EFig. 2.\u003C\/span\u003E \u003Cp id=\u0022p-14\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003EReduction of \u003Cem\u003ESgcg\u003C\/em\u003E transcript and loss of \u03b3-sarcoglycan protein expression in \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T muscle.\u003C\/strong\u003E (A) RT-PCR illustrating the presence of \u003Cem\u003ESgcg\u003C\/em\u003E (715\u2005bp) and \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T (714\u2005bp) transcripts. (B) Sequence chromatograms of the 5T region in the \u003Cem\u003ESgcg\u003C\/em\u003E and \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T transcripts illustrating the deletion of one thymine in exon 6 (red box) of the \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T transcript. (C) \u03b3-Sarcoglycan protein (red) was readily detected in WT muscle, but not in 521\u0394T muscle. Hoechst (blue) marked nuclei. (D) Immunoblot analysis revealed the presence of \u03b3-sarcoglycan protein in WT muscle lysates, whereas \u03b3-sarcoglycan was not detected in 521\u0394T muscle lysates. Data are mean\u00b1s.e.m. *\u003Cem\u003EP\u003C\/em\u003E\u0026lt;0.05 (\u003Cem\u003Et\u003C\/em\u003E-test). Scale bars: 50\u2005\u00b5m.\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-5\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EReduced mass and extensive muscle pathology in 521\u0394T mice\u003C\/h3\u003E\u003Cp id=\u0022p-15\u0022\u003ETo evaluate the effect of loss of \u03b3-sarcoglycan, mice were further characterized by monitoring total body mass and individual muscle mass. No significant difference in body mass was detected between 521\u0394T mice at 2\u2005months or 4\u2005months of age compared with WT controls (\u003Ca id=\u0022xref-fig-3-1\u0022 class=\u0022xref-fig\u0022 href=\u0022#F3\u0022\u003EFig.\u00a03\u003C\/a\u003EA). Examination of gluteus\/hamstring (GH) muscle mass normalized to tibia length revealed a reduction in muscle mass in 521\u0394T mice compared with WT controls (\u003Ca id=\u0022xref-fig-3-2\u0022 class=\u0022xref-fig\u0022 href=\u0022#F3\u0022\u003EFig.\u00a03\u003C\/a\u003EB). Compilation of muscle mass from multiple muscle groups (quadriceps, gluteus\/hamstring, triceps, diaphragm, heart, tibialis anterior combined) normalized to tibia length also revealed a reduction in muscle mass in 521\u0394T mice compared with WT controls (\u003Ca id=\u0022xref-fig-3-3\u0022 class=\u0022xref-fig\u0022 href=\u0022#F3\u0022\u003EFig.\u00a03\u003C\/a\u003EC). Correspondingly, the average cross-sectional area of 521\u0394T myofibers was reduced compared with WT control myofibers, measured using anti-dystrophin immunofluorescence staining to demarcate the sarcolemma (\u003Ca id=\u0022xref-fig-3-4\u0022 class=\u0022xref-fig\u0022 href=\u0022#F3\u0022\u003EFig.\u00a03\u003C\/a\u003ED,F). Fluorescence imaging also revealed that a greater percentage of 521\u0394T myofibers had increased internal myonuclei, at both 2\u2005months and 4\u2005months of age, compared with WT controls (\u003Ca id=\u0022xref-fig-3-5\u0022 class=\u0022xref-fig\u0022 href=\u0022#F3\u0022\u003EFig.\u00a03\u003C\/a\u003EE,F).\n\u003C\/p\u003E\u003Cdiv id=\u0022F3\u0022 class=\u0022fig pos-float odd\u0022\u003E\u003Cdiv class=\u0022highwire-figure\u0022\u003E\u003Cdiv class=\u0022fig-inline-img-wrapper\u0022\u003E\u003Cdiv class=\u0022fig-inline-img\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F3.large.jpg?width=800\u0026amp;height=600\u0026amp;carousel=1\u0022 title=\u0022Reduced mass and myofiber area in Sgcg 521\u0026#x394;T mice. (A) Body mass was not significantly different among genotypes. (B) Gluteus\/hamstring (GH) muscle mass normalized to tibia length was reduced in 521\u0026#x394;T mice compared with controls. (C) The total mass from muscle groups normalized to tibia length was significantly reduced in 521\u0026#x394;T mice compared with WT controls (quadriceps, gluteus\/hamstring, triceps, diaphragm, heart, tibialis anterior muscle groups combined). (D) Average myofiber cross-sectional area (CSA) was significantly smaller in 521\u0026#x394;T mice than in WT controls. (E) Percentage of myofibers with \u0026gt;1 internal nuclei was increased in 521\u0026#x394;T muscle, with 4-month-old 521\u0026#x394;T myofibers having the most internal nuclei. (F) Representative images of 521\u0026#x394;T and WT muscle. Anti-dystrophin (green) outlined myofibers. Hoechst (blue) demonstrated nuclei. Data are mean\u0026#xB1;s.e.m. *P\u0022 class=\u0022highwire-fragment fragment-images colorbox-load\u0022 rel=\u0022gallery-fragment-images-857853315\u0022 data-figure-caption=\u0022\u0026lt;div class=\u0026quot;highwire-markup\u0026quot;\u0026gt;\u0026lt;div xmlns=\u0026quot;http:\/\/www.w3.org\/1999\/xhtml\u0026quot;\u0026gt;\u0026lt;strong\u0026gt;Reduced mass and myofiber area in \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T mice.\u0026lt;\/strong\u0026gt; (A) Body mass was not significantly different among genotypes. (B) Gluteus\/hamstring (GH) muscle mass normalized to tibia length was reduced in 521\u0026#x394;T mice compared with controls. (C) The total mass from muscle groups normalized to tibia length was significantly reduced in 521\u0026#x394;T mice compared with WT controls (quadriceps, gluteus\/hamstring, triceps, diaphragm, heart, tibialis anterior muscle groups combined). (D) Average myofiber cross-sectional area (CSA) was significantly smaller in 521\u0026#x394;T mice than in WT controls. (E) Percentage of myofibers with \u0026gt;1 internal nuclei was increased in 521\u0026#x394;T muscle, with 4-month-old 521\u0026#x394;T myofibers having the most internal nuclei. (F) Representative images of 521\u0026#x394;T and WT muscle. Anti-dystrophin (green) outlined myofibers. Hoechst (blue) demonstrated nuclei. Data are mean\u0026#xB1;s.e.m. *\u0026lt;em\u0026gt;P\u0026lt;\/em\u0026gt;\u0026lt;0.05 (one-way ANOVA with Tukey; \u0026lt;em\u0026gt;n\u0026lt;\/em\u0026gt;\u0026#x2265;5 mice per group). Scale bars: 50\u0026#x2005;\u0026#xB5;m.\u0026lt;\/div\u0026gt;\u0026lt;\/div\u0026gt;\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003E\u003Cspan class=\u0022hw-responsive-img\u0022\u003E\u003Cimg class=\u0022highwire-fragment fragment-image lazyload\u0022 alt=\u0022Fig. 3.\u0022 src=\u0022data:image\/gif;base64,R0lGODlhAQABAIAAAAAAAP\/\/\/yH5BAEAAAAALAAAAAABAAEAAAIBRAA7\u0022 data-src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F3.medium.gif\u0022 width=\u0022440\u0022 height=\u0022286\u0022\/\u003E\u003Cnoscript\u003E\u003Cimg class=\u0022highwire-fragment fragment-image\u0022 alt=\u0022Fig. 3.\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F3.medium.gif\u0022 width=\u0022440\u0022 height=\u0022286\u0022\/\u003E\u003C\/noscript\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cul class=\u0022highwire-figure-links inline\u0022\u003E\u003Cli class=\u0022download-fig first\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F3.large.jpg?download=true\u0022 class=\u0022highwire-figure-link highwire-figure-link-download\u0022 title=\u0022Download Fig. 3.\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload figure\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022new-tab\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F3.large.jpg\u0022 class=\u0022highwire-figure-link highwire-figure-link-newtab\u0022 target=\u0022_blank\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EOpen in new tab\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339097\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cdiv class=\u0022fig-caption\u0022\u003E\u003Cspan class=\u0022fig-label\u0022\u003EFig. 3.\u003C\/span\u003E \u003Cp id=\u0022p-16\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003EReduced mass and myofiber area in \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T mice.\u003C\/strong\u003E (A) Body mass was not significantly different among genotypes. (B) Gluteus\/hamstring (GH) muscle mass normalized to tibia length was reduced in 521\u0394T mice compared with controls. (C) The total mass from muscle groups normalized to tibia length was significantly reduced in 521\u0394T mice compared with WT controls (quadriceps, gluteus\/hamstring, triceps, diaphragm, heart, tibialis anterior muscle groups combined). (D) Average myofiber cross-sectional area (CSA) was significantly smaller in 521\u0394T mice than in WT controls. (E) Percentage of myofibers with \u0026gt;1 internal nuclei was increased in 521\u0394T muscle, with 4-month-old 521\u0394T myofibers having the most internal nuclei. (F) Representative images of 521\u0394T and WT muscle. Anti-dystrophin (green) outlined myofibers. Hoechst (blue) demonstrated nuclei. Data are mean\u00b1s.e.m. *\u003Cem\u003EP\u003C\/em\u003E\u0026lt;0.05 (one-way ANOVA with Tukey; \u003Cem\u003En\u003C\/em\u003E\u22655 mice per group). Scale bars: 50\u2005\u00b5m.\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cp id=\u0022p-17\u0022\u003EHistological evaluation through hematoxylin \u0026amp; eosin (H\u0026amp;E) and Masson\u0027s Trichrome staining revealed that 521\u0394T muscles have muscular dystrophy pathological features, with evidence of increased immune infiltrate, fibrosis, necrosis, calcification, fiber size variability and internal nuclei (\u003Ca id=\u0022xref-fig-4-1\u0022 class=\u0022xref-fig\u0022 href=\u0022#F4\u0022\u003EFig.\u00a04\u003C\/a\u003E). Consistent with enhanced disease progression, histopathological features were more severe in 4-month-old 521\u0394T muscle than in 2-month-old 521\u0394T tissue (\u003Ca id=\u0022xref-fig-4-2\u0022 class=\u0022xref-fig\u0022 href=\u0022#F4\u0022\u003EFig.\u00a04\u003C\/a\u003E). The extent of immune infiltrate was quantified through immunofluorescence microscopy using an antibody to the macrophage cell surface marker F4\/80 and the monocyte\/neutrophil marker Ly6. 521\u0394T gastrocnemius muscle had a significantly increased number of F4\/80+ cells and Ly6+ cells per field compared with WT controls (\u003Ca id=\u0022xref-fig-5-1\u0022 class=\u0022xref-fig\u0022 href=\u0022#F5\u0022\u003EFig.\u00a05\u003C\/a\u003EA,B). In addition, loss of \u03b3-sarcoglycan protein due to the 521\u0394T mutation elicited a significant change in fiber type composition, assessed by myosin isoform immunostaining of the gastrocnemius muscle (\u003Ca id=\u0022xref-fig-5-2\u0022 class=\u0022xref-fig\u0022 href=\u0022#F5\u0022\u003EFig.\u00a05\u003C\/a\u003EC). 521\u0394T muscle had a significant reduction in the percentage of Type 2B fast glycolytic myofibers, with a trend towards an increased percentage of mixed myofibers (\u003Cem\u003EP\u003C\/em\u003E=0.07; 2B\/X, 2X, 2A\/X combined) compared with WT control muscle (\u003Ca id=\u0022xref-fig-5-3\u0022 class=\u0022xref-fig\u0022 href=\u0022#F5\u0022\u003EFig.\u00a05\u003C\/a\u003EC). These data show that loss of \u03b3-sarcoglycan protein due to the 521\u0394T mutation resulted in reduced muscle mass and enhanced muscle pathology.\n\u003C\/p\u003E\u003Cdiv id=\u0022F4\u0022 class=\u0022fig pos-float odd\u0022\u003E\u003Cdiv class=\u0022highwire-figure\u0022\u003E\u003Cdiv class=\u0022fig-inline-img-wrapper\u0022\u003E\u003Cdiv class=\u0022fig-inline-img\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F4.large.jpg?width=800\u0026amp;height=600\u0026amp;carousel=1\u0022 title=\u0022Marked dystrophic histopathology in Sgcg 521\u0026#x394;T mice. Tibialis anterior muscle from 521\u0026#x394;T mice displays hallmark signs of muscle disease including increased immune infiltrate, fibrosis, necrosis, calcification and internal myonuclei visualized through H\u0026amp;E and Masson\u0027s Trichrome staining. Older 521\u0026#x394;T mice (4\u0026#x2005;months) have more severe muscle pathology than younger 521\u0026#x394;T (2\u0026#x2005;months) mice. These features are absent in healthy WT muscle. Scale bars: 100\u0026#x2005;\u0026#xB5;m.\u0022 class=\u0022highwire-fragment fragment-images colorbox-load\u0022 rel=\u0022gallery-fragment-images-857853315\u0022 data-figure-caption=\u0022\u0026lt;div class=\u0026quot;highwire-markup\u0026quot;\u0026gt;\u0026lt;div xmlns=\u0026quot;http:\/\/www.w3.org\/1999\/xhtml\u0026quot;\u0026gt;\u0026lt;strong\u0026gt;Marked dystrophic histopathology in \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T mice.\u0026lt;\/strong\u0026gt; Tibialis anterior muscle from 521\u0026#x394;T mice displays hallmark signs of muscle disease including increased immune infiltrate, fibrosis, necrosis, calcification and internal myonuclei visualized through H\u0026amp;E and Masson\u0027s Trichrome staining. Older 521\u0026#x394;T mice (4\u0026#x2005;months) have more severe muscle pathology than younger 521\u0026#x394;T (2\u0026#x2005;months) mice. These features are absent in healthy WT muscle. Scale bars: 100\u0026#x2005;\u0026#xB5;m.\u0026lt;\/div\u0026gt;\u0026lt;\/div\u0026gt;\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003E\u003Cspan class=\u0022hw-responsive-img\u0022\u003E\u003Cimg class=\u0022highwire-fragment fragment-image lazyload\u0022 alt=\u0022Fig. 4.\u0022 src=\u0022data:image\/gif;base64,R0lGODlhAQABAIAAAAAAAP\/\/\/yH5BAEAAAAALAAAAAABAAEAAAIBRAA7\u0022 data-src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F4.medium.gif\u0022 width=\u0022440\u0022 height=\u0022290\u0022\/\u003E\u003Cnoscript\u003E\u003Cimg class=\u0022highwire-fragment fragment-image\u0022 alt=\u0022Fig. 4.\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F4.medium.gif\u0022 width=\u0022440\u0022 height=\u0022290\u0022\/\u003E\u003C\/noscript\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cul class=\u0022highwire-figure-links inline\u0022\u003E\u003Cli class=\u0022download-fig first\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F4.large.jpg?download=true\u0022 class=\u0022highwire-figure-link highwire-figure-link-download\u0022 title=\u0022Download Fig. 4.\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload figure\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022new-tab\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F4.large.jpg\u0022 class=\u0022highwire-figure-link highwire-figure-link-newtab\u0022 target=\u0022_blank\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EOpen in new tab\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339094\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cdiv class=\u0022fig-caption\u0022\u003E\u003Cspan class=\u0022fig-label\u0022\u003EFig. 4.\u003C\/span\u003E \u003Cp id=\u0022p-18\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003EMarked dystrophic histopathology in \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T mice.\u003C\/strong\u003E Tibialis anterior muscle from 521\u0394T mice displays hallmark signs of muscle disease including increased immune infiltrate, fibrosis, necrosis, calcification and internal myonuclei visualized through H\u0026amp;E and Masson\u0027s Trichrome staining. Older 521\u0394T mice (4\u2005months) have more severe muscle pathology than younger 521\u0394T (2\u2005months) mice. These features are absent in healthy WT muscle. Scale bars: 100\u2005\u00b5m.\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv id=\u0022F5\u0022 class=\u0022fig pos-float odd\u0022\u003E\u003Cdiv class=\u0022highwire-figure\u0022\u003E\u003Cdiv class=\u0022fig-inline-img-wrapper\u0022\u003E\u003Cdiv class=\u0022fig-inline-img\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F5.large.jpg?width=800\u0026amp;height=600\u0026amp;carousel=1\u0022 title=\u0022Increased immune infiltrate and fiber type switching in Sgcg 521\u0026#x394;T muscle. (A) Anti-F4\/80 immunofluorescence staining (green) of gastrocnemius muscle from 4-month-old mice revealed an increase in the average number of F4\/80+ macrophages per field in 521\u0026#x394;T muscle compared with WT controls. Hoechst (blue) labels nuclei. Arrows indicate F4\/80+ macrophages. (B) Anti-Ly6 immunofluorescence staining (green) of gastrocnemius muscle from 4-month-old mice revealed an increase in the average number of Ly6+ monocytes\/neutrophils in 521\u0026#x394;T muscle per field. Hoechst (blue) labels nuclei. Arrows indicate Ly6+ monocytes\/neutrophils. (C) Representative images and quantification of the fiber type composition of the gastrocnemius muscle from 4-month-old mice, evaluated through immunostaining against the different myosin isoforms. 521\u0026#x394;T muscle had a significant reduction in the percentage of Type 2B myofibers corresponding with a trend towards an increased number of mixed myofibers (P=0.07). Type 2B fibers (red), Type 2A (green), Type 1 (blue), mixed (composed of Type 2B\/X, 2X, 2A\/X). Data are mean\u0026#xB1;s.e.m. *P\u0022 class=\u0022highwire-fragment fragment-images colorbox-load\u0022 rel=\u0022gallery-fragment-images-857853315\u0022 data-figure-caption=\u0022\u0026lt;div class=\u0026quot;highwire-markup\u0026quot;\u0026gt;\u0026lt;div xmlns=\u0026quot;http:\/\/www.w3.org\/1999\/xhtml\u0026quot;\u0026gt;\u0026lt;strong\u0026gt;Increased immune infiltrate and fiber type switching in \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T muscle.\u0026lt;\/strong\u0026gt; (A) Anti-F4\/80 immunofluorescence staining (green) of gastrocnemius muscle from 4-month-old mice revealed an increase in the average number of F4\/80+ macrophages per field in 521\u0026#x394;T muscle compared with WT controls. Hoechst (blue) labels nuclei. Arrows indicate F4\/80+ macrophages. (B) Anti-Ly6 immunofluorescence staining (green) of gastrocnemius muscle from 4-month-old mice revealed an increase in the average number of Ly6+ monocytes\/neutrophils in 521\u0026#x394;T muscle per field. Hoechst (blue) labels nuclei. Arrows indicate Ly6+ monocytes\/neutrophils. (C) Representative images and quantification of the fiber type composition of the gastrocnemius muscle from 4-month-old mice, evaluated through immunostaining against the different myosin isoforms. 521\u0026#x394;T muscle had a significant reduction in the percentage of Type 2B myofibers corresponding with a trend towards an increased number of mixed myofibers (\u0026lt;em\u0026gt;P\u0026lt;\/em\u0026gt;=0.07). Type 2B fibers (red), Type 2A (green), Type 1 (blue), mixed (composed of Type 2B\/X, 2X, 2A\/X). Data are mean\u0026#xB1;s.e.m. *\u0026lt;em\u0026gt;P\u0026lt;\/em\u0026gt;\u0026lt;0.05 (\u0026lt;em\u0026gt;t\u0026lt;\/em\u0026gt;-test in A,B; two-way ANOVA with Bonferroni\u0027s correction in C; \u0026lt;em\u0026gt;n\u0026lt;\/em\u0026gt;=3 mice per group). Scale bars: 50\u0026#x2005;\u0026#xB5;m (A,B); 1 mm (C).\u0026lt;\/div\u0026gt;\u0026lt;\/div\u0026gt;\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003E\u003Cspan class=\u0022hw-responsive-img\u0022\u003E\u003Cimg class=\u0022highwire-fragment fragment-image lazyload\u0022 alt=\u0022Fig. 5.\u0022 src=\u0022data:image\/gif;base64,R0lGODlhAQABAIAAAAAAAP\/\/\/yH5BAEAAAAALAAAAAABAAEAAAIBRAA7\u0022 data-src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F5.medium.gif\u0022 width=\u0022440\u0022 height=\u0022405\u0022\/\u003E\u003Cnoscript\u003E\u003Cimg class=\u0022highwire-fragment fragment-image\u0022 alt=\u0022Fig. 5.\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F5.medium.gif\u0022 width=\u0022440\u0022 height=\u0022405\u0022\/\u003E\u003C\/noscript\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cul class=\u0022highwire-figure-links inline\u0022\u003E\u003Cli class=\u0022download-fig first\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F5.large.jpg?download=true\u0022 class=\u0022highwire-figure-link highwire-figure-link-download\u0022 title=\u0022Download Fig. 5.\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload figure\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022new-tab\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F5.large.jpg\u0022 class=\u0022highwire-figure-link highwire-figure-link-newtab\u0022 target=\u0022_blank\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EOpen in new tab\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339100\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cdiv class=\u0022fig-caption\u0022\u003E\u003Cspan class=\u0022fig-label\u0022\u003EFig. 5.\u003C\/span\u003E \u003Cp id=\u0022p-19\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003EIncreased immune infiltrate and fiber type switching in \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T muscle.\u003C\/strong\u003E (A) Anti-F4\/80 immunofluorescence staining (green) of gastrocnemius muscle from 4-month-old mice revealed an increase in the average number of F4\/80+ macrophages per field in 521\u0394T muscle compared with WT controls. Hoechst (blue) labels nuclei. Arrows indicate F4\/80+ macrophages. (B) Anti-Ly6 immunofluorescence staining (green) of gastrocnemius muscle from 4-month-old mice revealed an increase in the average number of Ly6+ monocytes\/neutrophils in 521\u0394T muscle per field. Hoechst (blue) labels nuclei. Arrows indicate Ly6+ monocytes\/neutrophils. (C) Representative images and quantification of the fiber type composition of the gastrocnemius muscle from 4-month-old mice, evaluated through immunostaining against the different myosin isoforms. 521\u0394T muscle had a significant reduction in the percentage of Type 2B myofibers corresponding with a trend towards an increased number of mixed myofibers (\u003Cem\u003EP\u003C\/em\u003E=0.07). Type 2B fibers (red), Type 2A (green), Type 1 (blue), mixed (composed of Type 2B\/X, 2X, 2A\/X). Data are mean\u00b1s.e.m. *\u003Cem\u003EP\u003C\/em\u003E\u0026lt;0.05 (\u003Cem\u003Et\u003C\/em\u003E-test in A,B; two-way ANOVA with Bonferroni\u0027s correction in C; \u003Cem\u003En\u003C\/em\u003E=3 mice per group). Scale bars: 50\u2005\u00b5m (A,B); 1 mm (C).\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-6\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EIncreased muscle leak and fibrosis in 521\u0394T mice\u003C\/h3\u003E\u003Cp id=\u0022p-20\u0022\u003EEvans Blue dye uptake was evaluated in skeletal muscles from 521\u0394T mice as a measure of muscle membrane instability and leak. Evans Blue dye is normally excluded from healthy, intact muscle, but is readily taken up by injured or compromised myofibers (\u003Ca id=\u0022xref-ref-21-3\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-21\u0022\u003EHack et al., 1998\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-31-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-31\u0022\u003EMatsuda et al., 1995\u003C\/a\u003E). Gross imaging revealed increased dye uptake in 521\u0394T diaphragm muscle compared with WT controls at 2 months and 4 months of age (\u003Ca id=\u0022xref-fig-6-1\u0022 class=\u0022xref-fig\u0022 href=\u0022#F6\u0022\u003EFig.\u00a06\u003C\/a\u003EA). Dye uptake was quantified by spectrophotometric analysis combining values from abdominal, quadriceps, gluteus\/hamstring, triceps, diaphragm, heart and gastrocnemius\/soleus muscles. Muscle from 2-month-old 521\u0394T mice contained significantly more dye than WT controls, and dye uptake in 4-month-old mice showed an increase (\u003Ca id=\u0022xref-fig-6-2\u0022 class=\u0022xref-fig\u0022 href=\u0022#F6\u0022\u003EFig.\u00a06\u003C\/a\u003EB). As a secondary measure of myofiber damage and leak, serum creatine kinase (CK) levels were assessed. CK is highly expressed in skeletal and cardiac muscle, and is released and detected in the serum after injury. Serum CK levels were increased in both 2-month-old and 4-month-old 521\u0394T mice compared with WT controls (\u003Ca id=\u0022xref-fig-6-3\u0022 class=\u0022xref-fig\u0022 href=\u0022#F6\u0022\u003EFig.\u00a06\u003C\/a\u003EC). In addition, 4-month-old 521\u0394T mice had significantly increased levels of serum CK compared with younger 2-month-old 521\u0394T mice (\u003Ca id=\u0022xref-fig-6-4\u0022 class=\u0022xref-fig\u0022 href=\u0022#F6\u0022\u003EFig.\u00a06\u003C\/a\u003EC).\n\u003C\/p\u003E\u003Cdiv id=\u0022F6\u0022 class=\u0022fig pos-float odd\u0022\u003E\u003Cdiv class=\u0022highwire-figure\u0022\u003E\u003Cdiv class=\u0022fig-inline-img-wrapper\u0022\u003E\u003Cdiv class=\u0022fig-inline-img\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F6.large.jpg?width=800\u0026amp;height=600\u0026amp;carousel=1\u0022 title=\u0022Increased sarcolemmal membrane leak and fibrosis in Sgcg 521\u0026#x394;T mice. (A) Mice were injected with Evans Blue dye. Gross imaging shows increased fibrosis (white; arrow) and increased dye uptake (blue streaks; arrowhead) in 521\u0026#x394;T mice compared with WT controls. (B) Increased dye uptake was seen in 2-month-old 521\u0026#x394;T muscle by spectrophotometric analysis compared with WT. This increase trended towards a reduction by 4 months of age in 521\u0026#x394;T muscle (compared with 2-month-old 521\u0026#x394;T muscle; P=0.07). Combined dye values from abdominal, quadriceps, gluteus\/hamstring, triceps, diaphragm, heart and gastroc\/soleus muscles. (C) Serum CK was elevated in 521\u0026#x394;T mice compared with controls, with 4-month-old 521\u0026#x394;T serum CK exceeding that of 2-month-old mutant animals. (D) Fibrosis was measured as HOP content. HOP content was elevated in 521\u0026#x394;T muscle, with more seen in 4-month-old 521\u0026#x394;T muscle than at 2\u0026#x2005;months of age. Combined values from abdominal, gastroc\/soleus, diaphragm and triceps. Data are mean\u0026#xB1;s.e.m. *P\u0022 class=\u0022highwire-fragment fragment-images colorbox-load\u0022 rel=\u0022gallery-fragment-images-857853315\u0022 data-figure-caption=\u0022\u0026lt;div class=\u0026quot;highwire-markup\u0026quot;\u0026gt;\u0026lt;div xmlns=\u0026quot;http:\/\/www.w3.org\/1999\/xhtml\u0026quot;\u0026gt;\u0026lt;strong\u0026gt;Increased sarcolemmal membrane leak and fibrosis in \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T mice.\u0026lt;\/strong\u0026gt; (A) Mice were injected with Evans Blue dye. Gross imaging shows increased fibrosis (white; arrow) and increased dye uptake (blue streaks; arrowhead) in 521\u0026#x394;T mice compared with WT controls. (B) Increased dye uptake was seen in 2-month-old 521\u0026#x394;T muscle by spectrophotometric analysis compared with WT. This increase trended towards a reduction by 4 months of age in 521\u0026#x394;T muscle (compared with 2-month-old 521\u0026#x394;T muscle; \u0026lt;em\u0026gt;P\u0026lt;\/em\u0026gt;=0.07). Combined dye values from abdominal, quadriceps, gluteus\/hamstring, triceps, diaphragm, heart and gastroc\/soleus muscles. (C) Serum CK was elevated in 521\u0026#x394;T mice compared with controls, with 4-month-old 521\u0026#x394;T serum CK exceeding that of 2-month-old mutant animals. (D) Fibrosis was measured as HOP content. HOP content was elevated in 521\u0026#x394;T muscle, with more seen in 4-month-old 521\u0026#x394;T muscle than at 2\u0026#x2005;months of age. Combined values from abdominal, gastroc\/soleus, diaphragm and triceps. Data are mean\u0026#xB1;s.e.m. *\u0026lt;em\u0026gt;P\u0026lt;\/em\u0026gt;\u0026lt;0.05 (one-way ANOVA with Tukey; \u0026lt;em\u0026gt;n\u0026lt;\/em\u0026gt;\u0026#x2265;4 mice per group). Scale bars: 5 mm.\u0026lt;\/div\u0026gt;\u0026lt;\/div\u0026gt;\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003E\u003Cspan class=\u0022hw-responsive-img\u0022\u003E\u003Cimg class=\u0022highwire-fragment fragment-image lazyload\u0022 alt=\u0022Fig. 6.\u0022 src=\u0022data:image\/gif;base64,R0lGODlhAQABAIAAAAAAAP\/\/\/yH5BAEAAAAALAAAAAABAAEAAAIBRAA7\u0022 data-src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F6.medium.gif\u0022 width=\u0022440\u0022 height=\u0022369\u0022\/\u003E\u003Cnoscript\u003E\u003Cimg class=\u0022highwire-fragment fragment-image\u0022 alt=\u0022Fig. 6.\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F6.medium.gif\u0022 width=\u0022440\u0022 height=\u0022369\u0022\/\u003E\u003C\/noscript\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cul class=\u0022highwire-figure-links inline\u0022\u003E\u003Cli class=\u0022download-fig first\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F6.large.jpg?download=true\u0022 class=\u0022highwire-figure-link highwire-figure-link-download\u0022 title=\u0022Download Fig. 6.\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload figure\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022new-tab\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F6.large.jpg\u0022 class=\u0022highwire-figure-link highwire-figure-link-newtab\u0022 target=\u0022_blank\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EOpen in new tab\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339095\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cdiv class=\u0022fig-caption\u0022\u003E\u003Cspan class=\u0022fig-label\u0022\u003EFig. 6.\u003C\/span\u003E \u003Cp id=\u0022p-21\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003EIncreased sarcolemmal membrane leak and fibrosis in \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T mice.\u003C\/strong\u003E (A) Mice were injected with Evans Blue dye. Gross imaging shows increased fibrosis (white; arrow) and increased dye uptake (blue streaks; arrowhead) in 521\u0394T mice compared with WT controls. (B) Increased dye uptake was seen in 2-month-old 521\u0394T muscle by spectrophotometric analysis compared with WT. This increase trended towards a reduction by 4 months of age in 521\u0394T muscle (compared with 2-month-old 521\u0394T muscle; \u003Cem\u003EP\u003C\/em\u003E=0.07). Combined dye values from abdominal, quadriceps, gluteus\/hamstring, triceps, diaphragm, heart and gastroc\/soleus muscles. (C) Serum CK was elevated in 521\u0394T mice compared with controls, with 4-month-old 521\u0394T serum CK exceeding that of 2-month-old mutant animals. (D) Fibrosis was measured as HOP content. HOP content was elevated in 521\u0394T muscle, with more seen in 4-month-old 521\u0394T muscle than at 2\u2005months of age. Combined values from abdominal, gastroc\/soleus, diaphragm and triceps. Data are mean\u00b1s.e.m. *\u003Cem\u003EP\u003C\/em\u003E\u0026lt;0.05 (one-way ANOVA with Tukey; \u003Cem\u003En\u003C\/em\u003E\u22654 mice per group). Scale bars: 5 mm.\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cp id=\u0022p-22\u0022\u003EAnother pathological feature of LGMD 2C is the progressive replacement of muscle tissue with fibrotic scar (\u003Ca id=\u0022xref-ref-21-4\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-21\u0022\u003EHack et al., 1998\u003C\/a\u003E). Gross imaging revealed extensive fibrotic remodeling of 521\u0394T tissue (white areas) at 2 months and 4 months of age compared with WT controls (\u003Ca id=\u0022xref-fig-6-5\u0022 class=\u0022xref-fig\u0022 href=\u0022#F6\u0022\u003EFig.\u00a06\u003C\/a\u003EA). Fibrotic content, measured by hydroxyproline (HOP) concentration from multiple muscles (abdominal, gastrocnemius\/soleus, diaphragm, triceps combined), were increased in both 521\u0394T cohorts compared with WT controls (\u003Ca id=\u0022xref-fig-6-6\u0022 class=\u0022xref-fig\u0022 href=\u0022#F6\u0022\u003EFig.\u00a06\u003C\/a\u003ED) (\u003Ca id=\u0022xref-ref-42-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-42\u0022\u003ESmith et al., 2016\u003C\/a\u003E). HOP content in muscle, reflecting scarring, increased with age, consistent with the progressive nature of the disease (\u003Ca id=\u0022xref-fig-6-7\u0022 class=\u0022xref-fig\u0022 href=\u0022#F6\u0022\u003EFig.\u00a06\u003C\/a\u003ED). These data combined demonstrate that the 521\u0394T mice develop progressive myopathy, hallmarked by muscle membrane leak and fibrotic replacement.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-7\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EWeakened muscles in Sgcg 521\u0394T mice\u003C\/h3\u003E\u003Cp id=\u0022p-23\u0022\u003ETo assess muscle function, muscle force was evaluated. Average forelimb grip strength was significantly decreased in 2-month-old and 4-month-old 521\u0394T mice compared with WT controls (\u003Ca id=\u0022xref-fig-7-1\u0022 class=\u0022xref-fig\u0022 href=\u0022#F7\u0022\u003EFig.\u00a07\u003C\/a\u003EA). To further evaluate muscle performance, \u003Cem\u003Ein situ\u003C\/em\u003E tetanic force of the tibialis anterior muscle was assessed in 4-month-old mice. Maximum tetanic force was significantly decreased in 521\u0394T mice compared with age-matched WT controls (\u003Ca id=\u0022xref-fig-7-2\u0022 class=\u0022xref-fig\u0022 href=\u0022#F7\u0022\u003EFig.\u00a07\u003C\/a\u003EB). Moreover, specific force, calculated as tetanic force normalized to muscle cross-sectional area, was also reduced in 521\u0394T mice compared with age-matched WT controls (\u003Ca id=\u0022xref-fig-7-3\u0022 class=\u0022xref-fig\u0022 href=\u0022#F7\u0022\u003EFig.\u00a07\u003C\/a\u003EC).\n\u003C\/p\u003E\u003Cdiv id=\u0022F7\u0022 class=\u0022fig pos-float odd\u0022\u003E\u003Cdiv class=\u0022highwire-figure\u0022\u003E\u003Cdiv class=\u0022fig-inline-img-wrapper\u0022\u003E\u003Cdiv class=\u0022fig-inline-img\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F7.large.jpg?width=800\u0026amp;height=600\u0026amp;carousel=1\u0022 title=\u0022Reduced muscle function in Sgcg 521\u0026#x394;T mice. (A) Average forelimb grip strength was decreased in 521\u0026#x394;T mice. (B) Increased maximum tetanic force was decreased in 521\u0026#x394;T mice at 4\u0026#x2005;months of age, measured through in situ force analysis of the tibialis anterior muscle. (C) Specific force was also decreased in 521\u0026#x394;T muscle compared with WT control (tibialis anterior, 4-month-old mice). (D) Respiratory muscle activity was also impaired. Enhanced pause (Penh) was elevated, consistent with abnormal breathing in 521\u0026#x394;T mice at 4\u0026#x2005;months, compared with WT controls. Data are mean\u0026#xB1;s.e.m. *P\u0022 class=\u0022highwire-fragment fragment-images colorbox-load\u0022 rel=\u0022gallery-fragment-images-857853315\u0022 data-figure-caption=\u0022\u0026lt;div class=\u0026quot;highwire-markup\u0026quot;\u0026gt;\u0026lt;div xmlns=\u0026quot;http:\/\/www.w3.org\/1999\/xhtml\u0026quot;\u0026gt;\u0026lt;strong\u0026gt;Reduced muscle function in \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T mice.\u0026lt;\/strong\u0026gt; (A) Average forelimb grip strength was decreased in 521\u0026#x394;T mice. (B) Increased maximum tetanic force was decreased in 521\u0026#x394;T mice at 4\u0026#x2005;months of age, measured through \u0026lt;em\u0026gt;in situ\u0026lt;\/em\u0026gt; force analysis of the tibialis anterior muscle. (C) Specific force was also decreased in 521\u0026#x394;T muscle compared with WT control (tibialis anterior, 4-month-old mice). (D) Respiratory muscle activity was also impaired. Enhanced pause (Penh) was elevated, consistent with abnormal breathing in 521\u0026#x394;T mice at 4\u0026#x2005;months, compared with WT controls. Data are mean\u0026#xB1;s.e.m. *\u0026lt;em\u0026gt;P\u0026lt;\/em\u0026gt;\u0026lt;0.05 (one-way ANOVA with Tukey in A; \u0026lt;em\u0026gt;t\u0026lt;\/em\u0026gt;-test in B,C,D; \u0026lt;em\u0026gt;n\u0026lt;\/em\u0026gt;\u0026#x2265;5 mice per group).\u0026lt;\/div\u0026gt;\u0026lt;\/div\u0026gt;\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003E\u003Cspan class=\u0022hw-responsive-img\u0022\u003E\u003Cimg class=\u0022highwire-fragment fragment-image lazyload\u0022 alt=\u0022Fig. 7.\u0022 src=\u0022data:image\/gif;base64,R0lGODlhAQABAIAAAAAAAP\/\/\/yH5BAEAAAAALAAAAAABAAEAAAIBRAA7\u0022 data-src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F7.medium.gif\u0022 width=\u0022440\u0022 height=\u0022149\u0022\/\u003E\u003Cnoscript\u003E\u003Cimg class=\u0022highwire-fragment fragment-image\u0022 alt=\u0022Fig. 7.\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F7.medium.gif\u0022 width=\u0022440\u0022 height=\u0022149\u0022\/\u003E\u003C\/noscript\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cul class=\u0022highwire-figure-links inline\u0022\u003E\u003Cli class=\u0022download-fig first\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F7.large.jpg?download=true\u0022 class=\u0022highwire-figure-link highwire-figure-link-download\u0022 title=\u0022Download Fig. 7.\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload figure\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022new-tab\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F7.large.jpg\u0022 class=\u0022highwire-figure-link highwire-figure-link-newtab\u0022 target=\u0022_blank\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EOpen in new tab\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339096\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cdiv class=\u0022fig-caption\u0022\u003E\u003Cspan class=\u0022fig-label\u0022\u003EFig. 7.\u003C\/span\u003E \u003Cp id=\u0022p-24\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003EReduced muscle function in \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T mice.\u003C\/strong\u003E (A) Average forelimb grip strength was decreased in 521\u0394T mice. (B) Increased maximum tetanic force was decreased in 521\u0394T mice at 4\u2005months of age, measured through \u003Cem\u003Ein situ\u003C\/em\u003E force analysis of the tibialis anterior muscle. (C) Specific force was also decreased in 521\u0394T muscle compared with WT control (tibialis anterior, 4-month-old mice). (D) Respiratory muscle activity was also impaired. Enhanced pause (Penh) was elevated, consistent with abnormal breathing in 521\u0394T mice at 4\u2005months, compared with WT controls. Data are mean\u00b1s.e.m. *\u003Cem\u003EP\u003C\/em\u003E\u0026lt;0.05 (one-way ANOVA with Tukey in A; \u003Cem\u003Et\u003C\/em\u003E-test in B,C,D; \u003Cem\u003En\u003C\/em\u003E\u22655 mice per group).\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cp id=\u0022p-25\u0022\u003ETo assess respiratory function, unanesthetized whole-body plethysmography (WBP) was performed on 4-month-old mice. Enhanced pause (referred to as Penh) is a calculation reflecting the timing and pattern of breathing [Penh=(PIP\/PEP)\u00d7Pause] (PIP, peak inspiratory pressure; PEP, peak expiratory pressure) (\u003Ca id=\u0022xref-ref-3-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-3\u0022\u003EAdler et al., 2004\u003C\/a\u003E). Higher Penh values are indicative of abnormal breathing, and Penh values were increased in 521\u0394T mice compared with control (\u003Ca id=\u0022xref-fig-7-4\u0022 class=\u0022xref-fig\u0022 href=\u0022#F7\u0022\u003EFig.\u00a07\u003C\/a\u003ED). When Penh was normalized to body mass, 521\u0394T mice trended towards increased values (\u003Cem\u003EP\u003C\/em\u003E=0.09; \u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S3\u003C\/a\u003E). Additional plethysmography parameters including minute volume\/body mass, peak inspiratory flow (PIF)\/body mass, peak expiratory flow (PEF)\/body mass, and pause were not significantly different between genotypes, whereas time relaxation (Tr) was trending towards significance at \u003Cem\u003EP\u003C\/em\u003E=0.09 (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S3\u003C\/a\u003E). Cardiac function was assessed using echocardiography, and percent fractional shortening was not significantly different than age-matched controls at 4 months of age, despite severe ventricular fibrosis visualized through gross imaging (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S4\u003C\/a\u003E, bottom panels). Of note, ventricular fibrosis was visible in a subset of WT mice on the DBA\/2J background at 4 months of age (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S4\u003C\/a\u003E, top panels). These data combined demonstrate that at 4 months of age, 521\u0394T mice had reduced limb muscle function, and cardiopulmonary function showed early signs of decline.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-8\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003E\u003Cem\u003EIn vivo\u003C\/em\u003E multi-exon skipping in 521\u0394T muscle\u003C\/h3\u003E\u003Cp id=\u0022p-26\u0022\u003ETo assess the ability to correct the reading frame of the 521\u0394T transcript \u003Cem\u003Ein vivo\u003C\/em\u003E, AONs were designed to murine \u003Cem\u003ESgcg\u003C\/em\u003E exons 4, 5, 6 and 7 (\u003Ca id=\u0022xref-fig-8-1\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003EA). AONs were designed complementary to the splice acceptor regions of \u003Cem\u003ESgcg\u003C\/em\u003E exons 4, 5, 6 and an intraexonic region in exon 7 (\u003Ca id=\u0022xref-table-wrap-1-1\u0022 class=\u0022xref-table\u0022 href=\u0022#T1\u0022\u003ETable\u00a01\u003C\/a\u003E). Chemical modifications of AONs promote stability, enhance RNA binding and prevent RNAse H degradation (\u003Ca id=\u0022xref-ref-6-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-6\u0022\u003EChan et al., 2006\u003C\/a\u003E). For these studies, we used phosphorodiamidate morpholino oligomers, which contained the vivo-modification for enhanced cell delivery (vivo-PMOs) (\u003Ca id=\u0022xref-ref-36-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-36\u0022\u003EMorcos et al., 2008\u003C\/a\u003E). Individual AONs were resuspended in Dulbecco\u0027s phosphate-buffered saline (DPBS), and then combined in a four-AON cocktail on the day of treatment (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003ETables\u00a0S1 and S2\u003C\/a\u003E). AONs were administered via intramuscular (IM) injection, as indicated, and their ability to correct the transcript reading frame was assessed via RT-PCR.\n\u003C\/p\u003E\u003Cdiv id=\u0022F8\u0022 class=\u0022fig pos-float odd\u0022\u003E\u003Cdiv class=\u0022highwire-figure\u0022\u003E\u003Cdiv class=\u0022fig-inline-img-wrapper\u0022\u003E\u003Cdiv class=\u0022fig-inline-img\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F8.large.jpg?width=800\u0026amp;height=600\u0026amp;carousel=1\u0022 title=\u0022In vivo exon skipping in Sgcg 521\u0026#x394;T muscle via IM injection of antisense oligonucleotides. (A) Schematic showing the correction of the 521\u0026#x394;T frameshift mutation (red triangle) with a multi-AON exon-skipping strategy targeting exons 4, 5, 6 and 7 (yellow boxes). This strategy corrects the reading frame by generating a transcript encoding Mini-Gamma, comprising exons 2, 3 and 8. The arrows depict the location of the PCR primers, and the expected amplicon size is designated. (B) Design and results from in vivo study 1, in which analysis was conducted 3\u0026#x2005;days after IM injections of AONs into the tibialis anterior (TA) and gastrocnemius\/soleus (Gas) muscle. Muscles were injected with either the four-AON cocktail or vehicle control (PBS; ctrl). Gel electrophoresis of RT-PCR products from treated muscles demonstrated the 521\u0026#x394;T transcript in PBS-treated muscle (black arrow), as well as a dose-dependent generation of the predicted transcript encoding Mini-Gamma in muscle treated with the Mini-Gamma vivo-PMO cocktail at a low and mid dose (red arrow). (C) Similar treatment of two additional mice for 7\u0026#x2005;days demonstrated similar results but suggested the need for higher AON dosing. (D) Design and results from in vivo study 2. RT-PCR results indicate robust generation of the transcript encoding Mini-Gamma after two injections, two weeks apart at both the mid and high doses (red arrow). A concomitant reduction in the unskipped 521\u0026#x394;T was also seen with both these exposures (black arrow). Mini-Gamma expression was evident 4\u0026#x2005;weeks after a single mid- or high-dose injection. However, expression was diminished compared with the two-injection treatment, and there were more intermediate products. (E) Gel extraction and subsequent Sanger sequencing confirmed that this product was in-frame Mini-Gamma.\u0022 class=\u0022highwire-fragment fragment-images colorbox-load\u0022 rel=\u0022gallery-fragment-images-857853315\u0022 data-figure-caption=\u0022\u0026lt;div class=\u0026quot;highwire-markup\u0026quot;\u0026gt;\u0026lt;div xmlns=\u0026quot;http:\/\/www.w3.org\/1999\/xhtml\u0026quot;\u0026gt;\u0026lt;strong\u0026gt;\u0026lt;em\u0026gt;In vivo\u0026lt;\/em\u0026gt; exon skipping in \u0026lt;em\u0026gt;Sgcg\u0026lt;\/em\u0026gt; 521\u0026#x394;T muscle via IM injection of antisense oligonucleotides.\u0026lt;\/strong\u0026gt; (A) Schematic showing the correction of the 521\u0026#x394;T frameshift mutation (red triangle) with a multi-AON exon-skipping strategy targeting exons 4, 5, 6 and 7 (yellow boxes). This strategy corrects the reading frame by generating a transcript encoding Mini-Gamma, comprising exons 2, 3 and 8. The arrows depict the location of the PCR primers, and the expected amplicon size is designated. (B) Design and results from \u0026lt;em\u0026gt;in vivo\u0026lt;\/em\u0026gt; study 1, in which analysis was conducted 3\u0026#x2005;days after IM injections of AONs into the tibialis anterior (TA) and gastrocnemius\/soleus (Gas) muscle. Muscles were injected with either the four-AON cocktail or vehicle control (PBS; ctrl). Gel electrophoresis of RT-PCR products from treated muscles demonstrated the 521\u0026#x394;T transcript in PBS-treated muscle (black arrow), as well as a dose-dependent generation of the predicted transcript encoding Mini-Gamma in muscle treated with the Mini-Gamma vivo-PMO cocktail at a low and mid dose (red arrow). (C) Similar treatment of two additional mice for 7\u0026#x2005;days demonstrated similar results but suggested the need for higher AON dosing. (D) Design and results from \u0026lt;em\u0026gt;in vivo\u0026lt;\/em\u0026gt; study 2. RT-PCR results indicate robust generation of the transcript encoding Mini-Gamma after two injections, two weeks apart at both the mid and high doses (red arrow). A concomitant reduction in the unskipped 521\u0026#x394;T was also seen with both these exposures (black arrow). Mini-Gamma expression was evident 4\u0026#x2005;weeks after a single mid- or high-dose injection. However, expression was diminished compared with the two-injection treatment, and there were more intermediate products. (E) Gel extraction and subsequent Sanger sequencing confirmed that this product was in-frame Mini-Gamma.\u0026lt;\/div\u0026gt;\u0026lt;\/div\u0026gt;\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003E\u003Cspan class=\u0022hw-responsive-img\u0022\u003E\u003Cimg class=\u0022highwire-fragment fragment-image lazyload\u0022 alt=\u0022Fig. 8.\u0022 src=\u0022data:image\/gif;base64,R0lGODlhAQABAIAAAAAAAP\/\/\/yH5BAEAAAAALAAAAAABAAEAAAIBRAA7\u0022 data-src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F8.medium.gif\u0022 width=\u0022440\u0022 height=\u0022285\u0022\/\u003E\u003Cnoscript\u003E\u003Cimg class=\u0022highwire-fragment fragment-image\u0022 alt=\u0022Fig. 8.\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F8.medium.gif\u0022 width=\u0022440\u0022 height=\u0022285\u0022\/\u003E\u003C\/noscript\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cul class=\u0022highwire-figure-links inline\u0022\u003E\u003Cli class=\u0022download-fig first\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F8.large.jpg?download=true\u0022 class=\u0022highwire-figure-link highwire-figure-link-download\u0022 title=\u0022Download Fig. 8.\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload figure\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022new-tab\u0022\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/dmm\/13\/2\/dmm040832\/F8.large.jpg\u0022 class=\u0022highwire-figure-link highwire-figure-link-newtab\u0022 target=\u0022_blank\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EOpen in new tab\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339093\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cdiv class=\u0022fig-caption\u0022\u003E\u003Cspan class=\u0022fig-label\u0022\u003EFig. 8.\u003C\/span\u003E \u003Cp id=\u0022p-27\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003E\u003Cem\u003EIn vivo\u003C\/em\u003E exon skipping in \u003Cem\u003ESgcg\u003C\/em\u003E 521\u0394T muscle via IM injection of antisense oligonucleotides.\u003C\/strong\u003E (A) Schematic showing the correction of the 521\u0394T frameshift mutation (red triangle) with a multi-AON exon-skipping strategy targeting exons 4, 5, 6 and 7 (yellow boxes). This strategy corrects the reading frame by generating a transcript encoding Mini-Gamma, comprising exons 2, 3 and 8. The arrows depict the location of the PCR primers, and the expected amplicon size is designated. (B) Design and results from \u003Cem\u003Ein vivo\u003C\/em\u003E study 1, in which analysis was conducted 3\u2005days after IM injections of AONs into the tibialis anterior (TA) and gastrocnemius\/soleus (Gas) muscle. Muscles were injected with either the four-AON cocktail or vehicle control (PBS; ctrl). Gel electrophoresis of RT-PCR products from treated muscles demonstrated the 521\u0394T transcript in PBS-treated muscle (black arrow), as well as a dose-dependent generation of the predicted transcript encoding Mini-Gamma in muscle treated with the Mini-Gamma vivo-PMO cocktail at a low and mid dose (red arrow). (C) Similar treatment of two additional mice for 7\u2005days demonstrated similar results but suggested the need for higher AON dosing. (D) Design and results from \u003Cem\u003Ein vivo\u003C\/em\u003E study 2. RT-PCR results indicate robust generation of the transcript encoding Mini-Gamma after two injections, two weeks apart at both the mid and high doses (red arrow). A concomitant reduction in the unskipped 521\u0394T was also seen with both these exposures (black arrow). Mini-Gamma expression was evident 4\u2005weeks after a single mid- or high-dose injection. However, expression was diminished compared with the two-injection treatment, and there were more intermediate products. (E) Gel extraction and subsequent Sanger sequencing confirmed that this product was in-frame Mini-Gamma.\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv id=\u0022T1\u0022 class=\u0022table pos-float\u0022\u003E\u003Cdiv class=\u0022table-inline table-callout-links\u0022\u003E\u003Cdiv class=\u0022callout\u0022\u003E\u003Cspan\u003EView this table:\u003C\/span\u003E\u003Cul class=\u0022callout-links\u0022\u003E\u003Cli class=\u0022view-inline first\u0022\u003E\u003Ca href=\u0022##\u0022 class=\u0022table-expand-inline\u0022 data-table-url=\u0022\/highwire\/markup\/1339101\/expansion?postprocessors=highwire_tables%2Chighwire_reclass%2Chighwire_figures%2Chighwire_math%2Chighwire_inline_linked_media%2Chighwire_embed\u0026amp;table-expand-inline=1\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EView inline\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022view-popup\u0022\u003E\u003Ca href=\u0022\/highwire\/markup\/1339101\/expansion?width=1000\u0026amp;height=500\u0026amp;iframe=true\u0026amp;postprocessors=highwire_tables%2Chighwire_reclass%2Chighwire_figures%2Chighwire_math%2Chighwire_inline_linked_media%2Chighwire_embed\u0022 class=\u0022colorbox colorbox-load table-expand-popup\u0022 rel=\u0022gallery-fragment-tables\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EView popup\u003C\/a\u003E\u003C\/li\u003E\u003Cli class=\u0022download-ppt last\u0022\u003E\u003Ca href=\u0022\/highwire\/powerpoint\/1339101\u0022 class=\u0022highwire-figure-link highwire-figure-link-ppt\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EDownload powerpoint\u003C\/a\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv class=\u0022table-caption\u0022\u003E\u003Cspan class=\u0022table-label\u0022\u003E\u003Cstrong\u003ETable\u00a01.\u003C\/strong\u003E\u003C\/span\u003E \u003Cp id=\u0022p-28\u0022 class=\u0022first-child\u0022\u003E\u003Cstrong\u003ESequences for AONs used in exon skipping\u003C\/strong\u003E\u003C\/p\u003E\u003Cdiv class=\u0022sb-div caption-clear\u0022\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cp id=\u0022p-29\u0022\u003EStudy 1 was conducted in four 9-week-old 521\u0394T mice (\u003Ca id=\u0022xref-fig-8-2\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003EB,C). Briefly, the right tibialis anterior and gastrocnemius\/soleus muscles were each injected with a four-AON cocktail as detailed in \u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003ETable\u00a0S1\u003C\/a\u003E. The contralateral tibialis anterior and gastrocnemius\/soleus muscles from the same mice were injected with an equal volume of vehicle. Muscles from the first set of mice were analyzed 3\u00a0days after IM injection, and those from the second set were evaluated 7\u00a0days after IM injection. RT-PCR analysis for the \u003Cem\u003ESgcg\u003C\/em\u003E transcript demonstrated expression of the 521\u0394T transcript and the endogenous skipping of exon 7 in muscle treated with vehicle alone. A dose-dependent generation of the predicted transcript encoding Mini-Gamma was seen in muscles injected with the four-AON multi-exon skipping cocktail (\u003Ca id=\u0022xref-fig-8-3\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003EB,C). This dose-dependent expression of Mini-Gamma persisted for 7\u00a0days after IM injection (\u003Ca id=\u0022xref-fig-8-4\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003EC).\u003C\/p\u003E\u003Cp id=\u0022p-30\u0022\u003EStudy 2 was initiated in 5-week-old 521\u0394T mice and continued for 4\u2005weeks (\u003Ca id=\u0022xref-fig-8-5\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003ED). In two of three mice in this study, the tibialis anterior was injected with a mid- or high dose of the four-AON cocktail, whereas the contralateral TA was injected with a control AON (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003ETable\u00a0S2\u003C\/a\u003E). These two mice received two rounds of injections, an initial injection (day 0) with a second injection after 2 weeks (day 14), and mice were sacrificed for analysis 28\u2005days after the first injection (\u003Ca id=\u0022xref-fig-8-6\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003ED). The third mouse received only an initial injection (day 0) of Mini-Gamma AONs (a single mid-dose in the right TA, and a single high dose in the left TA) and was sacrificed on day 28 post injection. RT-PCR analysis demonstrated that both bi-weekly injection regimens generated robust expression of the transcript encoding Mini-Gamma for both the mid- and high dose (\u003Ca id=\u0022xref-fig-8-7\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003ED). However, only the high dose maintained Mini-Gamma expression 4 weeks after a single administration (\u003Ca id=\u0022xref-fig-8-8\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003ED). The correct sequence of the transcript was confirmed using Sanger sequencing (\u003Ca id=\u0022xref-fig-8-9\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003EE). Collectively, these data show that the Mini-Gamma four-AON cocktail corrected the 521\u0394T reading frame, producing the transcript in multiple muscle tissues \u003Cem\u003Ein vivo\u003C\/em\u003E.\u003C\/p\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv class=\u0022section discussion\u0022 id=\u0022sec-9\u0022\u003E\u003Ch2 class=\u0022\u0022\u003EDISCUSSION\u003C\/h2\u003E\u003Cdiv id=\u0022sec-10\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EA new model for testing LGMD therapy\u003C\/h3\u003E\u003Cp id=\u0022p-31\u0022\u003EThe previous well-characterized mouse model for LGMD 2C was useful to elucidate basic mechanisms of sarcolemmal instability and for testing gene replacement therapy (\u003Ca id=\u0022xref-ref-11-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-11\u0022\u003ECordier et al., 2000\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-22-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-22\u0022\u003EHack et al., 2000\u003C\/a\u003E, \u003Ca id=\u0022xref-ref-21-5\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-21\u0022\u003E1998\u003C\/a\u003E). This previous model was also useful for showing that transgenic expression of Mini-Gamma protein was functional and could alleviate the dystrophic phenotype (\u003Ca id=\u0022xref-ref-17-4\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-17\u0022\u003EGao et al., 2015\u003C\/a\u003E). Although significant progress is being made using viral gene replacement therapy, current approaches are limited by neutralizing antibodies and potential immune response to the expressed protein. At the same time, genetic correction using AON-meditated exon skipping has received approval from the FDA for the treatment of DMD and for spinal muscular atrophy (\u003Ca id=\u0022xref-ref-1-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-1\u0022\u003EAartsma-Rus and Krieg, 2017\u003C\/a\u003E). Previous studies using a four-AON cocktail were piloted using patient-derived human cell lines, including an LGMD 2C patient carrying the most common 521\u0394T mutation (\u003Ca id=\u0022xref-ref-47-5\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-47\u0022\u003EWyatt et al., 2018\u003C\/a\u003E). In the previous studies, vivo-PMOs appeared to have better efficacy for skipping, although this likely relates to modifications to improve AON access into cells. Despite this success, an appropriate \u003Cem\u003Ein vivo\u003C\/em\u003E model to test this therapeutic was lacking. We have now used CRISPR\/Cas9 gene editing to develop a precision model of LGMD 2C. This model demonstrated a dystrophic phenotype and muscle pathology similar to that observed in patients with the most severe forms of the disease and generates a new platform that is genetically appropriate for testing multi-exon skipping.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-11\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EChallenges for \u003Cem\u003Ein vivo\u003C\/em\u003E studies\u003C\/h3\u003E\u003Cp id=\u0022p-32\u0022\u003ETransgenic rescue of the dystrophic phenotype in \u003Cem\u003ESgcg-\u003C\/em\u003Enull mice used a muscle-specific transgene to overexpress the Mini-Gamma protein compared with full-length WT protein (\u003Ca id=\u0022xref-ref-17-5\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-17\u0022\u003EGao et al., 2015\u003C\/a\u003E). This earlier study used \u003Cem\u003ESgcg\u003C\/em\u003E mice in the C57BL\/6J background, which is known to have a milder phenotype than those in the DBA\/2J background (\u003Ca id=\u0022xref-ref-23-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-23\u0022\u003EHeydemann et al., 2005\u003C\/a\u003E). The current study created the 521\u0394T mutation on the C57BL\/6J background and then backcrossed to the DBA2\/J background, ensuring the presence of the severe homozygous \u003Cem\u003ELtbp4\u003C\/em\u003E allele (\u003Ca id=\u0022xref-ref-24-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-24\u0022\u003EHeydemann et al., 2009\u003C\/a\u003E). The \u003Cem\u003ELtbp4\u003C\/em\u003E allele contributes significantly to generating increased fibrosis and membrane leak, contributing up to 40% of the phenotypic variance (\u003Ca id=\u0022xref-ref-44-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-44\u0022\u003ESwaggart et al., 2014\u003C\/a\u003E). 521\u0394T mice on the C57BL\/6J background were not extensively bred or phenotyped, limiting comparisons of phenotypic differences between the DBA\/2J and C57BL\/6J strains. This 521\u0394T DBA\/2J model demonstrates reduced muscle mass, increased fibrosis and muscle membrane leak, similar to that seen when dystrophin gene mutations are in the DBA\/2J background (\u003Ca id=\u0022xref-ref-9-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-9\u0022\u003EColey et al., 2016\u003C\/a\u003E). We did not observe a reduction in left ventricular cardiac function, and we expect that this relates to the relatively young age of the mice, as \u003Cem\u003ESgcg\u003C\/em\u003E-null mice in this same DBA\/2J background demonstrate cardiopulmonary decline at 6\u2005months of age (\u003Ca id=\u0022xref-ref-39-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-39\u0022\u003EQuattrocelli et al., 2017b\u003C\/a\u003E). However, the trend toward decline in respiratory parameters and evidence for cardiac fibrosis at 4 months of age can be viewed as earlier indicators that are expected to progress, mirroring the progression that is observed in human patients.\u003C\/p\u003E\u003Cp id=\u0022p-33\u0022\u003EWe have now used this model to conduct pilot experiments testing AON-mediated exon skipping directly in muscle. The complexity of multi-exon skipping relies on AONs being taken up into individual myofibers. Exon skipping studies in a canine DMD model suggest that multi-exon skipping is feasible (\u003Ca id=\u0022xref-ref-30-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-30\u0022\u003ELim et al., 2019\u003C\/a\u003E). Herein, we show successful generation of the transcript encoding Mini-Gamma in skeletal muscle \u003Cem\u003Ein vivo\u003C\/em\u003E. Evaluating multi exon-skipping-induced Mini-Gamma protein expression and function is a critical next step. We expect that systemic, repetitive administration of the AON cocktail will be required to reliably detect protein expression. In addition, optimization of dosage for each AON will be required to determine the optimal regimen that elicits Mini-Gamma protein expression and ultimately pathological and functional benefit in the 521\u0394T model. It is also likely that AON sequence optimization will impact the degree of Mini-Gamma production. The current AON sequences predominately target the exon splice acceptor sites; however, efficient skipping has been observed using intraexonic sequences that target exon splicing elements (\u003Ca id=\u0022xref-ref-2-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-2\u0022\u003EAartsma-Rus and van Ommen, 2007\u003C\/a\u003E). Although there are some differences between the human and mouse intraexonic sequences, the location of these putative sites is similar relative to the exon start site in both species.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-12\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EBroader applications for the 521\u0394T model\u003C\/h3\u003E\u003Cp id=\u0022p-34\u0022\u003EThe generation of an LGMD 2C model through the introduction of the most common 521\u0394T mutation will have broader applications. This is one of the few models that requires multi-exon skipping to achieve gene correction and enables better assessment of this potential. Although this is more difficult to execute systemically, it allows for more potential therapeutic targets that can impact larger populations of patients (\u003Ca id=\u0022xref-ref-14-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-14\u0022\u003EEchigoya and Yokota, 2014\u003C\/a\u003E). Furthermore, new chemistries are in development to improve delivery and reduce dosage. These include the tricyclo-AON modification and the use of ultrapure stereoisomers of AON compounds (\u003Ca id=\u0022xref-ref-19-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-19\u0022\u003EGoyenvalle et al., 2015\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-27-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-27\u0022\u003EIwamoto et al., 2017\u003C\/a\u003E). This model allows not only the study of LGMD 2C, but also the interrogation of these systems in a multi-exon skipping setting. Finally, this model will allow the potential use of gene editing with CRISPR to correct the same mutation this system introduced, paving the way for the next generation of gene therapies.\u003C\/p\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv class=\u0022section methods\u0022 id=\u0022sec-13\u0022\u003E\u003Ch2 class=\u0022\u0022\u003EMATERIALS AND METHODS\u003C\/h2\u003E\u003Cdiv id=\u0022sec-14\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EGene-edited zygotes\u003C\/h3\u003E\u003Cp id=\u0022p-35\u0022\u003EMice harboring the \u003Cem\u003ESgcg\u003C\/em\u003E exon 6 521\u0394T single thymine deletion mutation were generated through the Northwestern University Transgenic and Targeted Mutagenesis Laboratory (TTML). Briefly, gRNA targeting the locus were identified using the CRISPR Design Tool (crispr.mit.edu). The optimal gRNA was identified on the anti-sense strand with the sequence 5\u2032-TGTTCAAAAAGAGCTCCTTCTGG-3\u2032. The gRNA complex was synthesized using the GeneArt Precision gRNA Synthesis Kit (A29377, Thermo Fisher Scientific). Cas9 mRNA was purchased from Thermo Fisher Scientific (GeneArt A29378). The 200\u00a0nt single-stranded (ssODN) ultramer repair template, harboring the single thymine deletion, was synthesized and PAGE purified by Integrated DNA Technologies. It was designed towards the antisense strand as follows 5\u2032-atgagaacgtttgtttatattgagtaaattcttacCTAAGGTCTTGAAATGGGTCAGCTCTGACAAGGGGTGTCTCCACTGAGTGTTCAAAAGAGCTCCTTCTGGCCctaaaagaagaccagagatgtgtcagagacaaaagtacaagaagtagcctcagccaaactaacagacagtcca-3\u2032 (upper case indicates exonic sequence; lower case indicates intronic sequence). All CRISPR components were microinjected into the cytoplasm of zygotes.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-15\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EMouse generation\u003C\/h3\u003E\u003Cp id=\u0022p-36\u0022\u003EMice were bred and housed in a specific pathogen-free facility on a 12-h light\/dark cycle and fed \u003Cem\u003Ead libitum\u003C\/em\u003E in accordance with and under the approval of the Northwestern University Institutional Animal Care and Use Committee. After pronuclear injection, embryos were transferred into pseudo-pregnant C57BL\/6J mice. Tail DNA was isolated from 13 potential founders using the Qiagen PureGene Tissue Isolation Kit (158667, Qiagen). Tail DNA was genotyped using the following primer set flanking \u003Cem\u003ESgcg\u003C\/em\u003E exon 6: primer SAF 5\u2032-TGTACAAAAAAGCAGGCTTTAAAG-3\u2032 and primer SAR 5\u2032-TAATGCCAACTTTGTACAAGAAAG-3\u2032. PCR products were Sanger sequenced using the same primer set, and examined for the presence of the 521\u0394T point mutation. PCR products from three potential founders were cloned into the TOPO p2.1 cloning vector (K450001, Thermo Fisher Scientific) and analyzed for the presence of the 521\u0394T allele. A single male with a heterozygous 521\u0394T mutation was bred with a WT C57BL\/6J female. The heterozygous F1 offspring was then backcrossed into the DBA\/2J mouse strain for five generations to generate a more severe dystrophic phenotype (\u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003EFig.\u00a0S1\u003C\/a\u003E). These mice were genotyped for the deleterious \u003Cem\u003ELtbp4\u003C\/em\u003E allele, as described in \u003Ca id=\u0022xref-ref-24-3\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-24\u0022\u003EHeydemann et al. (2009)\u003C\/a\u003E and \u003Ca id=\u0022xref-ref-44-3\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-44\u0022\u003ESwaggart et al. (2014)\u003C\/a\u003E.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-16\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003E521\u0394T characterization\u003C\/h3\u003E\u003Cp id=\u0022p-37\u0022\u003EMuscle was dissected from 521\u0394T D2BA\/2J F5 mice bred to homozygosity along with the muscle from WT littermates. Muscle was flash frozen in liquid nitrogen. Total RNA was isolated from the tibialis anterior as described below, and analyzed for the expression of the \u003Cem\u003ESgcg\u003C\/em\u003E and 521\u0394T transcripts using the following primer sets: F, 5\u2032-ACTCACATAGAGAGGCCCGA-3\u2032; R, 5\u2032-CCATCAGGACACGCACAGAT-3\u2032. Individual bands were gel extracted, purified using the Qiaex 2 Gel Extraction Kit (20021, Qiagen) and submitted for Sanger sequencing. Extracted PCR products were also subcloned into the TOPO PCR 2.1 vector described above, mini-prepped and submitted for Sanger sequencing. For detection of \u03b3-sarcoglycan, 10\u2005\u00b5m muscle sections were fixed for 2\u2005min in ice-cold methanol. After fixation, muscle was rinsed with PBS, blocked in PBS plus 10% fetal bovine serum and 0.1% Triton X-100 (9002-93-1, Sigma-Aldrich) for 1\u2005h at 4\u00b0C, then incubated with anti-\u03b3-sarcoglycan antibody (1:250; \u003Ca id=\u0022xref-ref-33-3\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-33\u0022\u003EMcNally, 1996\u003C\/a\u003Ea). Sections were rinsed and incubated with goat anti-rabbit IgG H\u0026amp;L Alexa-Fluor-594 secondary antibody (150080, Abcam, 1:2500) and Hoechst 33342 (H3570, Thermo Fisher Scientific, 1:10,000) for 1\u2005h at room temperature. Sections were fixed in Vectashield mounting media (H-1000, Vector Laboratories) and imaged on a Zeiss Observer microscope using Zen Pro software.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-17\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003ERNA isolation\u003C\/h3\u003E\u003Cp id=\u0022p-38\u0022\u003EFresh or flash-frozen muscle was directly added to 1\u2005ml of Trizol reagent (15596026, Thermo Fisher Scientific) containing zirconia\/silica beads (11079125z, BioSpec Products). The samples were homogenized for 1\u2005min using a BioSpec bead beater. After homogenization, samples were spun at 12,000\u2005\u003Cstrong\u003E\u003Cem\u003Eg\u003C\/em\u003E\u003C\/strong\u003E for 5\u2005min at 4\u00b0C. Then 900\u2005\u00b5l of supernatant was transferred to 1.5\u2005ml tubes, 200\u2005\u03bcl of chloroform was added to the samples, shaken and incubated for 5\u2005min at room temperature. Samples were then spun at 12,000\u2005\u003Cstrong\u003E\u003Cem\u003Eg\u003C\/em\u003E\u003C\/strong\u003E for 15\u2005min at 4\u00b0C. The supernatant was then transferred to a fresh 1.5\u2005ml tube and further processed using the Aurum RNA Isolation Kit (7326820, Bio-Rad Laboratories). Finally, 1\u2005\u00b5g of RNA was reverse-transcribed to cDNA using the qScript reagent (95048, Quantabio).\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-18\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EImmunoblotting\u003C\/h3\u003E\u003Cp id=\u0022p-39\u0022\u003EMuscles were dissected and lysed in whole-tissue lysis buffer [50\u2005mM HEPES (pH 7.5), 150\u2005mM NaCl, 2\u2005mM EDTA, 10\u2005mM NaF, 10\u2005mM Na-pyrophosphate, 10% glycerol, 1% Triton X-100, 1\u2005mM phenyl-methylsulfonyl fluoride (PMSF), 1\u00d7 cOmplete\u2122 Protease Inhibitor Cocktail (11697498001 CO-RO, Roche)] using a glass dounce tissue grinder. The protein concentration of the muscle or cell lysate was determined using the Quick Start\u2122 Bradford Protein Assay (5000205, Bio-Rad Laboratories). Proteins were separated on a 10% Mini-Protean\u003Csup\u003E\u00ae\u003C\/sup\u003E TGX\u2122 Precast Protein Gel, 15-well, 15\u2005\u00b5l (4561036, Bio-Rad Laboratories) and transferred to Immun-Blot PVDF Membranes for protein blotting (1620177, Bio-Rad Laboratories). Blocking and antibody incubations were carried out using StartingBlock T20 (TBS) Blocking Buffer (37543, Thermo Fisher Scientific). The primary antibody used was Novocastra\u003Csup\u003ETM\u003C\/sup\u003E lyophilized mouse monoclonal antibody gamma-sarcoglycan (NCL-g-SARC, Leica Biosystems). Goat anti-mouse secondary antibody conjugated to horseradish peroxidase (115-035-003; Jackson ImmunoResearch) was used at a dilution of 1:2500. SuperSignal\u2122 West Pico Chemiluminescent Substrate and SuperSignal\u2122 West Femto Maximum Sensitivity Substrate (34080 and 34096, respectively, Thermo Fisher Scientific) were applied to membranes and membranes were visualized using an Invitrogen\u2122 iBright\u2122 CL1000 imaging system (A32749; Thermo Fisher Scientific). Pierce\u2122 Reversible Protein Stain Kit for PVDF Membranes (24585, Thermo Fisher Scientific) was used to stain the blot to ensure complete transfer and equal loading. Immunoblot bands were quantified using FIJI gel analysis tools.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-19\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EImmunofluorescence microscopy\u003C\/h3\u003E\u003Cp id=\u0022p-40\u0022\u003EFor detection of dystrophin, 10\u2005\u00b5m muscle sections were fixed with 4% PFA made from 16% paraformaldehyde solution (15710, Electron Microscopy Sciences). After fixation, muscle was rinsed with PBS, blocked in PBS plus 10% fetal bovine serum and 0.1% Triton X-100 (9002-93-1; Sigma-Aldrich) for 1\u2005h at 4C, then incubated with anti-dystrophin primary antibody (PA1-37587, Thermo Fisher Scientific) at 1:100 overnight at 4\u00b0C. Sections were rinsed and then secondary goat anti-rabbit IgG H\u0026amp;L Alexa-Fluor-488 (150077, Abcam, 1:2500) and Hoechst (1:10,000) were used for 1\u2005h at room temperature. All samples were fixed in ProLong\u003Csup\u003E\u00ae\u003C\/sup\u003E Gold Antifade Mountant (P36930; Thermo Fisher Scientific) and imaged on a Zeiss Observer microscope using Zen Pro software.\u003C\/p\u003E\u003Cp id=\u0022p-41\u0022\u003EImmunofluorescence staining to evaluate fiber type was performed as described below. Frozen muscle sections (10\u2005\u00b5m) of the gastrocnemius muscle were fixed in ice-cold acetone for 5\u2005min, rinsed in PBS and then blocked in 1% bovine serum albumin and 10% fetal bovine serum in PBS for 1\u2005h. For fiber typing, sections were incubated with primary antibodies BA-F8 (1:10), SC-71 (1:30) and BF-F3 (1:10), all from the Developmental Studies Hybridoma Bank, overnight at 4\u00b0C. Sections were rinsed in PBS plus 1% bovine serum albumin and then incubated with secondary antibodies Alexa-Fluor-350 anti-IgG2b, Alexa-Fluor-488 anti-IgG1, and Alexa-Fluor-594 anti-IgM (A21140, A21121 and 1010111, respectively, Life Technologies; all used at 1:500) for 1\u2005h. Following secondary incubation, sections were again rinsed in PBS plus 1% bovine serum albumin. All primary and secondary antibodies were diluted in a 1% bovine serum albumin PBS solution. All steps were carried out at room temperature using room temperature reagents, except where noted. All samples were fixed in ProLong\u003Csup\u003E\u00ae\u003C\/sup\u003E Gold Antifade Mountant (P36930; Thermo Fisher Scientific) and imaged on a Zeiss Observer microscope using Zen Pro software. Type 2B, Mixed (2B\/X, 2X, 2X\/A combined), Type 2A and Type 1 fibers were quantified and expressed as the % of total myofibers per muscle section.\u003C\/p\u003E\u003Cp id=\u0022p-42\u0022\u003EFor immune cell detection, sections were fixed in formalin for 10\u2005min, then rinsed in PBS. Sections were blocked with 1% bovine serum albumin and 10% fetal bovine serum (F4\/80) or 0.1% Triton X-100 and 10% fetal bovine serum (Ly6). Following blocking, sections were incubated with a combination of anti-dystrophin at a dilution of 1:100 and either anti-F4\/80 conjugated to Alexa-Fluor-488 (ab6640; Abcam, 1:100) or anti-Ly6 conjugated to FITC (553126; BD Biosciences, 1:100) overnight at 4\u00b0C. Sections were rinsed in cold PBS, following which sections were incubated with secondary goat anti-rabbit IgG H\u0026amp;L Alexa-Fluor-594 (A-11012; Invitrogen, 1:2500) and Hoechst (1:10,000) for 1\u2005h at 4\u00b0C. All steps were carried out on ice using cold reagents. All samples were fixed in ProLong Gold Antifade Mountant (P36930; Thermo Fisher Scientific) and imaged on a Zeiss Observer microscope using Zen Pro software. Immune cell number was quantified from at least three fields per muscle, from \u003Cem\u003En\u003C\/em\u003E=3 mice per genotype, at 4\u2005m of age. Data is expressed as the average number of positive cells per field.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-20\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EPhysiologic analyses\u003C\/h3\u003E\u003Cdiv id=\u0022sec-21\u0022 class=\u0022subsection\u0022\u003E\u003Ch4\u003EBody weight and muscle analysis\u003C\/h4\u003E\u003Cp id=\u0022p-43\u0022\u003ETotal body mass was determined and, after sacrifice, tibia lengths were measured. Raw body mass was normalized to the average tibia length. Muscles were removed and immediately weighed. Muscle mass was normalized to tibia length. Excised muscles were immediately frozen in liquid nitrogen, placed in pre-cooled Nalgene cryovials and stored at \u221280\u00b0C or placed in Fisher HealthCare\u2122 Protocol\u2122 10% buffered formalin (23-305510, Thermo Fisher Scientific) for processing.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-22\u0022 class=\u0022subsection\u0022\u003E\u003Ch4\u003EGrip strength\u003C\/h4\u003E\u003Cp id=\u0022p-44\u0022\u003EGrip strength assessments were performed using a Chantillon Ametek Force Transducer in a Columbus Instruments apparatus. Mice were held firmly by the tail, allowed to grasp the attached triangular bar equally with both forepaws, and then pulled away horizontally until the grip was released. Force was recorded for 10 consecutive pulls separated by 15\u2005s. Values are reported as the average of the trials and as average force normalized to whole body weight. The same operator performed all assessments and was blinded to genotype.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-23\u0022 class=\u0022subsection\u0022\u003E\u003Ch4\u003EPlethysmography\u003C\/h4\u003E\u003Cp id=\u0022p-45\u0022\u003EUnanesthetized WBP was used to measure respiratory function using a Data Sciences International, Buxco Finepointe 4-site WBP as described (\u003Ca id=\u0022xref-ref-38-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-38\u0022\u003EQuattrocelli et al., 2017a\u003C\/a\u003E). Individual mice were placed in a calibrated cylindrical chamber. Each mouse was allowed to acclimate to the plethysmography chamber for 120\u2005min before recording was initiated. Mice were generally resting during acquisition. Data was recorded for a total of 20\u2005min. Studies were performed at room temperature. Data analysis included breaths with a 0 Rejection Index (Rinx) and in a frequency range of 100-250 breaths per minute. Data was also normalized to body mass (g) where appropriate.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-24\u0022 class=\u0022subsection\u0022\u003E\u003Ch4\u003ESerum collection\u003C\/h4\u003E\u003Cp id=\u0022p-46\u0022\u003ESerum was acquired and processed as described (\u003Ca id=\u0022xref-ref-12-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-12\u0022\u003EDemonbreun et al., 2016\u003C\/a\u003E). Briefly, blood was collected by means of retro-orbital puncture with heparinized capillary tubes (20-362-566, Thermo Fisher Scientific) into a Microtainer\u2122 Gold Top Serum Separator (365967, Becton Dickinson) and centrifuged at 8000\u2005\u003Cstrong\u003E\u003Cem\u003Eg\u003C\/em\u003E\u003C\/strong\u003E for 10\u2005min. The plasma fractions were frozen and stored at \u221280\u00b0C.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-25\u0022 class=\u0022subsection\u0022\u003E\u003Ch4\u003ESerum biomarkers\u003C\/h4\u003E\u003Cp id=\u0022p-47\u0022\u003ESerum CK was analyzed in triplicate for each mouse using the EnzyChrom Creatine Kinase Assay (ECPK-100, BioAssay Systems) following the manufacturer\u0027s instructions. Results were acquired with the Synergy HTX multi-mode plate reader (BioTek\u003Csup\u003E\u00ae\u003C\/sup\u003E).\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-26\u0022 class=\u0022subsection\u0022\u003E\u003Ch4\u003EEchocardiography\u003C\/h4\u003E\u003Cp id=\u0022p-48\u0022\u003E\u003Cem\u003EIn vivo\u003C\/em\u003E cardiac function was assessed by echocardiography and was conducted under anesthesia (0.8\u2005liters\/min, 1% vaporized isoflurane in 100% O\u003Csub\u003E2\u003C\/sub\u003E) as described previously (\u003Ca id=\u0022xref-ref-4-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-4\u0022\u003EBarefield et al., 2017\u003C\/a\u003E). Echocardiography was performed using a Visual Sonics Vevo 2100 imaging system with a MS550D 22-55\u2005MHz solid-state transducer (FujiFilm). Cardiac function was assessed using short-axis M-mode to measure left ventricular wall thickness and chamber diameter. Heart rate was maintained \u0026gt;450 beats per minute to minimize variability. Percent fractional shortening was calculated as: 100\u00d7[(LV diastolic diameter\u2212LV systolic diameter)\/LV diastolic diameter].\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-27\u0022 class=\u0022subsection\u0022\u003E\u003Ch4\u003E\u003Cem\u003EIn situ\u003C\/em\u003E force and fatigue\u003C\/h4\u003E\u003Cp id=\u0022p-49\u0022\u003EMuscle mechanics were performed as described previously (\u003Ca id=\u0022xref-ref-38-2\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-38\u0022\u003EQuattrocelli et al., 2017a\u003C\/a\u003E). Briefly, immediately before sacrifice, \u003Cem\u003Ein situ\u003C\/em\u003E tetanic force from tibialis anterior muscle was measured using a Whole Mouse Test System (#1300A, Aurora Scientific) with a 1\u2005N dual-action lever arm force transducer (300C-LR, Aurora Scientific) in anesthetized animals (0.8\u2005liters\/min of 1.5% isoflurane in 100% O\u003Csub\u003E2\u003C\/sub\u003E). Both muscles per animal were assayed. Tetanic isometric contraction was induced with following specifications: initial delay, 0.1\u2005s; frequency, 200\u2005Hz; pulse width, 0.5\u2005ms; duration, 0.5\u2005s; using 100\u2005mA stimulation. Length was adjusted to a fixed baseline of 50\u2005mN resting tension for all muscles\/conditions. Specific force was calculated as tetanic force normalized to muscle cross-sectional area assayed for each muscle from every animal. Fatigue analysis was conducted by repeating tetanic contractions every 10\u2005s until complete exhaustion of the muscle (25 cycles). Time of contraction was assessed as time to maximum tetanic value within the 0.0-0.5\u2005s range of each tetanic contraction, and time of relaxation was assessed as time to 90% minimum tetanic value within the 0.5-0.8\u2005s range of every tetanus.\u003C\/p\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-28\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EEvans Blue dye uptake quantification\u003C\/h3\u003E\u003Cp id=\u0022p-50\u0022\u003EEvans Blue dye uptake was measured as described previously (\u003Ca id=\u0022xref-ref-24-4\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-24\u0022\u003EHeydemann et al., 2009\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-45-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-45\u0022\u003EThurston et al., 1999\u003C\/a\u003E). Mice were injected intraperitoneally with 5\u2005\u00b5l\/g of 10\u2005\u00b5M Evans Blue dye (E2129, Sigma-Aldrich). Mice were sacrificed \u223c24\u2005h post injection. Multiple muscle groups were assessed including the abdominal, diaphragm, quadriceps, gastrocnemius\/soleus, gluteus\/hamstrings and triceps and values normalized to tissue weight and kidney dye uptake. Each sample was assessed in duplicate. Absorbance was measured at 620\u2005nm on a Synergy HTX multi-mode plate reader (BioTek\u003Csup\u003E\u00ae\u003C\/sup\u003E). Results are reported as arbitrary optical density units\/mg of tissue.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-29\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EHydroxyproline quantification\u003C\/h3\u003E\u003Cp id=\u0022p-51\u0022\u003EThe content of hydroxyproline in each tissue was assayed as described previously (\u003Ca id=\u0022xref-ref-16-1\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-16\u0022\u003EFlesch et al., 1997\u003C\/a\u003E; \u003Ca id=\u0022xref-ref-24-5\u0022 class=\u0022xref-bibr\u0022 href=\u0022#ref-24\u0022\u003EHeydemann et al., 2009\u003C\/a\u003E). Skeletal muscle tissues (quadriceps, abdominal, gastrocnemius\/soleus, gluteus\/hamstrings, diaphragm and triceps) were assayed. A standard curve was created using 0-5000\u2005nMol hydroxyproline (H-5534, Sigma-Aldrich) as starting material and the zero mM standard was used as a blank when measuring absorbance. Each sample was assessed in triplicate. Amount of hydroxyproline in each tissue was normalized to tissue mass, and the results are reported as nMol hydroxyproline\/mg tissue.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-30\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EMuscle analysis\u003C\/h3\u003E\u003Cp id=\u0022p-52\u0022\u003EMuscles were dissected and frozen in liquid nitrogen. Anti-dystrophin sarcolemmal fluorescence outlined individual myofibers and was used to assess the myofiber mean cross-sectional area automatically using FIJI (NIH) from at least five fields per mouse. The percentage of fibers with central nuclei marked by Hoechst fluorescence was calculated from the number of fibers containing internalized nuclei in each image\/the total number of fibers counted per image, standardized as a percentage. Images were captured using a Zeiss Axiophot microscope.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-31\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EHistology\u003C\/h3\u003E\u003Cp id=\u0022p-53\u0022\u003EExcised muscles were placed in 10% formaldehyde (245-684, Thermo Fisher Scientific) for histological processing. Sections (10\u2005\u03bcm thick) from the center of paraffin-embedded muscles were stained with H\u0026amp;E (12013B and 1070C, Newcomer Supply) and Masson trichrome (HT-15, Sigma-Aldrich). Images were captured using a Zeiss Axiophot microscope.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-32\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EVivo-PMOs\u003C\/h3\u003E\u003Cp id=\u0022p-54\u0022\u003EVivo-PMOs were designed according to described guidelines and synthesized as 25-mer vivo-PMOs by GeneTools. Specific AON sequences and their exon targets are listed in \u003Ca id=\u0022xref-table-wrap-1-2\u0022 class=\u0022xref-table\u0022 href=\u0022#T1\u0022\u003ETable\u00a01\u003C\/a\u003E. A non-targeting vivo-PMO standard control was purchased from GeneTools (CCTCTTACCTCAGTTACAATTTATA). Vivo-PMO were resuspended in pure DPBS to a stock concentration of 0.5\u2005mM.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-33\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EIM injection of vivo-PMO\u003C\/h3\u003E\u003Cp id=\u0022p-55\u0022\u003EA four-AON vivo-PMO cocktail was directly injected into the tibialis anterior or gastrocnemius\/soleus of 521\u0394T mice between the ages of 5 and 9\u2005weeks old. Briefly, the four-AON cocktail was combined in a final volume of 20-40\u2005\u03bcl of DPBS as indicated in \u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003ETable\u00a0S2\u003C\/a\u003E. Either DPBS or a non-targeting vivo-PMO was used as a control. Mice were anesthetized using isoflurane. Mice underwent either a single or multi-injection regimen, as detailed in \u003Ca id=\u0022xref-fig-8-10\u0022 class=\u0022xref-fig\u0022 href=\u0022#F8\u0022\u003EFig.\u00a08\u003C\/a\u003E. Total RNA from these samples was isolated, reverse-transcribed, sequenced and analyzed as described above.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv id=\u0022sec-34\u0022 class=\u0022subsection\u0022\u003E\u003Ch3\u003EStatistical analysis\u003C\/h3\u003E\u003Cp id=\u0022p-56\u0022\u003EStatistical analyses were performed using Prism software v7.0a (Graphpad). When comparing two groups, two-tailed Student\u0027s \u003Cem\u003Et\u003C\/em\u003E-test with Welch\u0027s correction (unequal variances) was used. When comparing three or more groups of data for only one variable, one-way ANOVA with Tukey multi-comparison was used, whereas a two-way ANOVA was used for two variables. \u003Cem\u003EP\u003C\/em\u003E-value \u22640.05 was considered significant. Data were presented as single values were appropriate. In analyses pooling larger data point sets per group, Tukey distribution bars were used to emphasize data range distribution. Error bars represent\u00b1s.e.m.\u003C\/p\u003E\u003Cp id=\u0022p-57\u0022\u003EThis article is part of a special collection \u2018A Guide to Using Neuromuscular Disease Models for Basic and Preclinical Studies\u2019, which was launched in a dedicated issue guest edited by Annemieke Aartsma-Rus, Maaike van Putten and James Dowling. See related articles in this collection at \u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/collection\/neuromuscular\u0022\u003Ehttp:\/\/www.stormoverpacific.com\/collection\/neuromuscular\u003C\/a\u003E.\u003C\/p\u003E\u003C\/div\u003E\u003C\/div\u003E\u003Cdiv class=\u0022section ack\u0022 id=\u0022ack-1\u0022\u003E\u003Ch2 class=\u0022\u0022\u003EAcknowledgements\u003C\/h2\u003E\u003Cp id=\u0022p-58\u0022\u003EWe acknowledge the outstanding support of the Transgenic and Targeted Mutagenesis Laboratory (TTML) at Northwestern University.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv class=\u0022section fn-group\u0022 id=\u0022fn-group-1\u0022\u003E\u003Ch2\u003EFootnotes\u003C\/h2\u003E\u003Cul\u003E\u003Cli class=\u0022fn-conflict\u0022 id=\u0022fn-2\u0022\u003E\u003Cp id=\u0022p-59\u0022\u003E\u003Cstrong\u003ECompeting interests\u003C\/strong\u003E\u003C\/p\u003E\u003Cp id=\u0022p-60\u0022\u003EE.M.M. and E.J.W. are co-inventors of a patent related to exon skipping (US Patent 9,777,271).\u003C\/p\u003E\u003C\/li\u003E\u003Cli class=\u0022fn\u0022 id=\u0022fn-3\u0022\u003E\u003Cp id=\u0022p-61\u0022\u003E\u003Cstrong\u003EAuthor contributions\u003C\/strong\u003E\u003C\/p\u003E\u003Cp id=\u0022p-62\u0022\u003EConceptualization: A.R.D., E.J.W., E.M.M.; Methodology: A.R.D., E.J.W., M.Q., D.Y.B., E.M.M.; Formal analysis: A.R.D., E.J.W., K.S.F., M.H., M.Q., D.Y.B., E.M.M.; Investigation: A.R.D., E.J.W., K.S.F., C.C.O., M.H., P.G.P., M.Q., D.Y.B.; Data curation: A.R.D., E.J.W., K.S.F.; Writing - original draft: A.R.D., E.J.W., E.M.M.; Writing - review \u0026amp; editing: A.R.D., E.J.W., E.M.M.; Visualization: A.R.D., K.S.F.\u003C\/p\u003E\u003C\/li\u003E\u003Cli class=\u0022fn-financial-disclosure\u0022 id=\u0022fn-4\u0022\u003E\u003Cp id=\u0022p-63\u0022\u003E\u003Cstrong\u003EFunding\u003C\/strong\u003E\u003C\/p\u003E\u003Cp id=\u0022p-64\u0022\u003EThis work was supported by the National Institutes of Health (HL61322, AR052646) and the Kurt+Peter Foundation.\u003C\/p\u003E\u003C\/li\u003E\u003Cli class=\u0022fn-supplementary-material\u0022 id=\u0022fn-5\u0022\u003E\u003Cp id=\u0022p-65\u0022\u003E\u003Cstrong\u003ESupplementary information\u003C\/strong\u003E\u003C\/p\u003E\u003Cp id=\u0022p-66\u0022\u003ESupplementary information available online at \u003Ca href=\u0022http:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u0022\u003Ehttp:\/\/www.stormoverpacific.com\/lookup\/doi\/10.1242\/dmm.040832.supplemental\u003C\/a\u003E\u003C\/p\u003E\u003C\/li\u003E\u003C\/ul\u003E\u003C\/div\u003E\u003Cul class=\u0022history-list\u0022\u003E\u003Cli xmlns:hwp=\u0022http:\/\/schema.highwire.org\/Journal\u0022 class=\u0022received\u0022 hwp:start=\u00222019-06-03\u0022\u003E\u003Cspan class=\u0022received-label\u0022\u003EReceived \u003C\/span\u003EJune 3, 2019.\u003C\/li\u003E\u003Cli xmlns:hwp=\u0022http:\/\/schema.highwire.org\/Journal\u0022 class=\u0022accepted\u0022 hwp:start=\u00222019-09-23\u0022\u003E\u003Cspan class=\u0022accepted-label\u0022\u003EAccepted \u003C\/span\u003ESeptember 23, 2019.\u003C\/li\u003E\u003C\/ul\u003E\u003Cul class=\u0022copyright-statement\u0022\u003E\u003Cli class=\u0022fn\u0022 id=\u0022copyright-statement-1\u0022\u003E\u00a9 2019. Published by The Company of Biologists Ltd\u003C\/li\u003E\u003C\/ul\u003E\u003Cdiv class=\u0022license\u0022 id=\u0022license-1\u0022\u003E\u003Cspan class=\u0022ali-license-ref\u0022\u003E\u003Ca href=\u0022http:\/\/creativecommons.org\/licenses\/by\/4.0\u0022 rel=\u0022license\u0022\u003Ehttp:\/\/creativecommons.org\/licenses\/by\/4.0\u003C\/a\u003E\u003C\/span\u003E\u003Cp id=\u0022p-2\u0022\u003EThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (\u003Ca href=\u0022https:\/\/creativecommons.org\/licenses\/by\/4.0\u0022 rel=\u0022license\u0022\u003Ehttps:\/\/creativecommons.org\/licenses\/by\/4.0\u003C\/a\u003E), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed.\u003C\/p\u003E\u003C\/div\u003E\u003Cdiv class=\u0022section ref-list\u0022 id=\u0022ref-list-1\u0022\u003E\u003Ch2 class=\u0022\u0022\u003EReferences\u003C\/h2\u003E\u003Col class=\u0022cit-list ref-use-labels\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-1-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-1\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.1\u0022 data-doi=\u002210.1089\/nat.2016.0657\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAartsma-Rus\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKrieg\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2017\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EFDA approves eteplirsen for Duchenne muscular dystrophy: the next chapter in the Eteplirsen saga\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENucleic Acid Ther.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E27\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E3\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1089\/nat.2016.0657\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNucleic%2BAcid%2BTher.%26rft.volume%253D27%26rft.spage%253D1%26rft_id%253Dinfo%253Adoi%252F10.1089%252Fnat.2016.0657%26rft_id%253Dinfo%253Apmid%252F27929755%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1089\/nat.2016.0657\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=27929755\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-2-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-2\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.2\u0022 data-doi=\u002210.1261\/rna.653607\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAartsma-Rus\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003Evan Ommen\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.-J. B.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2007\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EAntisense-mediated exon skipping: a versatile tool with therapeutic and research applications\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ERNA\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E13\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1609\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E1624\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1261\/rna.653607\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DRNA%26rft_id%253Dinfo%253Adoi%252F10.1261%252Frna.653607%26rft_id%253Dinfo%253Apmid%252F17684229%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Mzoicm5hIjtzOjU6InJlc2lkIjtzOjEwOiIxMy8xMC8xNjA5IjtzOjQ6ImF0b20iO3M6MjQ6Ii9kbW0vMTMvMi9kbW0wNDA4MzIuYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-3-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-3\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.3\u0022 data-doi=\u002210.1152\/japplphysiol.00821.2003\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAdler\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECieslewicz\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EIrvin\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. G.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2004\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EUnrestrained plethysmography is an unreliable measure of airway responsiveness in BALB\/c and C57BL\/6 mice\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Appl. Physiol.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E97\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E286\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E292\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1152\/japplphysiol.00821.2003\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJ.%2BAppl.%2BPhysiol.%26rft_id%253Dinfo%253Adoi%252F10.1152%252Fjapplphysiol.00821.2003%26rft_id%253Dinfo%253Apmid%252F15033965%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1152\/japplphysiol.00821.2003\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=15033965\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000222310700036\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-4-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-4\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.4\u0022 data-doi=\u002210.1161\/CIRCULATIONAHA.117.028585\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBarefield\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. Y.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPuckelwartz\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. J.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKim\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. Y.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWilsbacher\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. D.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVo\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. H.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWaters\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEarley\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. U.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHadhazy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDellefave-Castillo\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPesce\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. L.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2017\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EExperimental modeling supports a role for MyBP-HL as a novel myofilament component in arrhythmia and dilated cardiomyopathy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ECirculation\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E136\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1477\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E1491\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1161\/CIRCULATIONAHA.117.028585\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DCirculation%26rft_id%253Dinfo%253Adoi%252F10.1161%252FCIRCULATIONAHA.117.028585%26rft_id%253Dinfo%253Apmid%252F28778945%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MTQ6ImNpcmN1bGF0aW9uYWhhIjtzOjU6InJlc2lkIjtzOjExOiIxMzYvMTYvMTQ3NyI7czo0OiJhdG9tIjtzOjI0OiIvZG1tLzEzLzIvZG1tMDQwODMyLmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-5-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-5\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.5\u0022 data-doi=\u002210.1212\/WNL.40.12.1903\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBen Jelloun-Dellagi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EChaffey\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EP.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHentati\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBen Hamida\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ETome\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EColin\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDellagi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKaplan\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. C.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EFardeau\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBen Hamida\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1990\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EPresence of normal dystrophin in Tunisian severe childhood autosomal recessive muscular dystrophy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENeurology\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E40\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1903\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1212\/WNL.40.12.1903\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNeurology%26rft.volume%253D40%26rft.spage%253D1903%26rft_id%253Dinfo%253Adoi%252F10.1212%252FWNL.40.12.1903%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1212\/WNL.40.12.1903\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-6-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-6\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.6\u0022 data-doi=\u002210.1111\/j.1440-1681.2006.04403.x\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EChan\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. H. P.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELim\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWong\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EW. S. F.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2006\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EAntisense oligonucleotides: from design to therapeutic application\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EClin. Exp. Pharmacol. Physiol.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E33\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E533\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E540\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1111\/j.1440-1681.2006.04403.x\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DClinical%2Band%2Bexperimental%2Bpharmacology%2B%2526%2Bphysiology%26rft.stitle%253DClin%2BExp%2BPharmacol%2BPhysiol%26rft.aulast%253DChan%26rft.auinit1%253DJ.%2BH.%26rft.volume%253D33%26rft.issue%253D5-6%26rft.spage%253D533%26rft.epage%253D540%26rft.atitle%253DAntisense%2Boligonucleotides%253A%2Bfrom%2Bdesign%2Bto%2Btherapeutic%2Bapplication.%26rft_id%253Dinfo%253Adoi%252F10.1111%252Fj.1440-1681.2006.04403.x%26rft_id%253Dinfo%253Apmid%252F16700890%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1111\/j.1440-1681.2006.04403.x\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=16700890\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000237420800019\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-7-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-7\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.7\u0022 data-doi=\u002210.1038\/mtna.2014.57\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EClayton\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EN. P.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENelson\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWeeden\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ETaylor\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMoreland\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER. J.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EScheule\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER. K.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPhillips\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELeger\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. J.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECheng\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES. H.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWentworth\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EB. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2014\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EAntisense oligonucleotide-mediated suppression of muscle glycogen synthase 1 synthesis as an approach for substrate reduction therapy of Pompe disease\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EMol. Ther. Nucleic Acids\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E3\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003Ee206\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1038\/mtna.2014.57\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DMol.%2BTher.%2BNucleic%2BAcids%26rft.volume%253D3%26rft.spage%253D206e%26rft_id%253Dinfo%253Adoi%252F10.1038%252Fmtna.2014.57%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1038\/mtna.2014.57\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-8-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-8\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.8\u0022 data-doi=\u002210.1002\/1097-4598(200010)23:10\u0026lt;1456::AID-MUS2\u0026gt;3.0.CO;2-T\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECohn\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER. D.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECampbell\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. P.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2000\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EMolecular basis of muscular dystrophies\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EMuscle Nerve\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E23\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1456\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E1471\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1002\/1097-4598(200010)23:10\u0026lt;1456::AID-MUS2\u0026gt;3.0.CO;2-T\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DMuscle%2B%2526%2Bnerve%26rft.stitle%253DMuscle%2BNerve%26rft.aulast%253DCohn%26rft.auinit1%253DR.%2BD.%26rft.volume%253D23%26rft.issue%253D10%26rft.spage%253D1456%26rft.epage%253D1471%26rft.atitle%253DMolecular%2Bbasis%2Bof%2Bmuscular%2Bdystrophies.%26rft_id%253Dinfo%253Adoi%252F10.1002%252F1097-4598%2528200010%252923%253A10%253C1456%253A%253AAID-MUS2%253E3.0.CO%253B2-T%26rft_id%253Dinfo%253Apmid%252F11003781%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1002\/1097-4598(200010)23:10\u0026lt;1456::AID-MUS2\u0026gt;3.0.CO;2-T\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=11003781\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000089572500002\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-9-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-9\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.9\u0022 data-doi=\u002210.1093\/hmg\/ddv460\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EColey\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EW. D.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBogdanik\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVila\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. C.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EYu\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EQ.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVan Der Meulen\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. H.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ERayavarapu\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENovak\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. S.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENearing\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EQuinn\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. L.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESaunders\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2016\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EEffect of genetic background on the dystrophic phenotype in mdx mice\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EHum. Mol. Genet.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E25\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E130\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E145\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1093\/hmg\/ddv460\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DHum.%2BMol.%2BGenet.%26rft_id%253Dinfo%253Adoi%252F10.1093%252Fhmg%252Fddv460%26rft_id%253Dinfo%253Apmid%252F26566673%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1093\/hmg\/ddv460\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=26566673\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-10-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-10\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.10\u0022 data-doi=\u002210.1126\/science.1231143\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECong\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ERan\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECox\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELin\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBarretto\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHabib\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EN.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHsu\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EP. D.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWu\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EX.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EJiang\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EW.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMarraffini\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. A.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2013\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EMultiplex genome engineering using CRISPR\/Cas systems\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EScience\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E339\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E819\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E823\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1126\/science.1231143\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DScience%26rft_id%253Dinfo%253Adoi%252F10.1126%252Fscience.1231143%26rft_id%253Dinfo%253Apmid%252F23287718%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Mzoic2NpIjtzOjU6InJlc2lkIjtzOjEyOiIzMzkvNjEyMS84MTkiO3M6NDoiYXRvbSI7czoyNDoiL2RtbS8xMy8yL2RtbTA0MDgzMi5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-11-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-11\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.11\u0022 data-doi=\u002210.1006\/mthe.1999.0019\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECordier\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHack\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EScott\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. O.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBarton-Davis\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGao\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWilson\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESweeney\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH. L.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2000\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003ERescue of skeletal muscles of gamma-sarcoglycan-deficient mice with adeno-associated virus-mediated gene transfer\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EMol. Ther.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E1\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E119\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E129\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1006\/mthe.1999.0019\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DMolecular%2Btherapy%2B%253A%2B%2Bthe%2Bjournal%2Bof%2Bthe%2BAmerican%2BSociety%2Bof%2BGene%2BTherapy%26rft.stitle%253DMol%2BTher%26rft.aulast%253DCordier%26rft.auinit1%253DL.%26rft.volume%253D1%26rft.issue%253D2%26rft.spage%253D119%26rft.epage%253D129%26rft.atitle%253DRescue%2Bof%2Bskeletal%2Bmuscles%2Bof%2Bgamma-sarcoglycan-deficient%2Bmice%2Bwith%2Badeno-associated%2Bvirus-mediated%2Bgene%2Btransfer.%26rft_id%253Dinfo%253Adoi%252F10.1006%252Fmthe.1999.0019%26rft_id%253Dinfo%253Apmid%252F10933922%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1006\/mthe.1999.0019\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10933922\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000090018500004\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-12-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-12\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.12\u0022 data-doi=\u002210.1016\/j.ajpath.2016.02.005\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDemonbreun\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAllen\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. V.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWarner\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. L.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBarefield\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. Y.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKrishnan\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESwanson\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. E.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEarley\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. U.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2016\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EEnhanced muscular dystrophy from loss of dysferlin is accompanied by impaired Annexin A6 translocation after sarcolemmal disruption\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EAm. J. Pathol.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E186\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1610\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E1622\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/j.ajpath.2016.02.005\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DAm.%2BJ.%2BPathol.%26rft.volume%253D186%26rft.spage%253D1610%26rft_id%253Dinfo%253Adoi%252F10.1016%252Fj.ajpath.2016.02.005%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/j.ajpath.2016.02.005\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-13-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-13\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.13\u0022 data-doi=\u002210.1016\/S0959-437X(02)00309-X\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDurbeej\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECampbell\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. P.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2002\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EMuscular dystrophies involving the dystrophin-glycoprotein complex: an overview of current mouse models\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ECurr. Opin. Genet. Dev.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E12\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E349\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E361\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/S0959-437X(02)00309-X\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DCurrent%2Bopinion%2Bin%2Bgenetics%2B%2526%2Bdevelopment%26rft.stitle%253DCurr%2BOpin%2BGenet%2BDev%26rft.aulast%253DDurbeej%26rft.auinit1%253DM.%26rft.volume%253D12%26rft.issue%253D3%26rft.spage%253D349%26rft.epage%253D361%26rft.atitle%253DMuscular%2Bdystrophies%2Binvolving%2Bthe%2Bdystrophin-glycoprotein%2Bcomplex%253A%2Ban%2Boverview%2Bof%2Bcurrent%2Bmouse%2Bmodels.%26rft_id%253Dinfo%253Adoi%252F10.1016%252FS0959-437X%252802%252900309-X%26rft_id%253Dinfo%253Apmid%252F12076680%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/S0959-437X(02)00309-X\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=12076680\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000175383900014\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-14-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-14\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.14\u0022 data-doi=\u002210.1089\/nat.2013.0451\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEchigoya\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EYokota\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2014\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003ESkipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENucleic Acid Ther.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E24\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E57\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E68\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1089\/nat.2013.0451\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNucleic%2BAcid%2BTher.%26rft.volume%253D24%26rft.spage%253D57%26rft_id%253Dinfo%253Adoi%252F10.1089%252Fnat.2013.0451%26rft_id%253Dinfo%253Apmid%252F24380394%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1089\/nat.2013.0451\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=24380394\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-15-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-15\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.15\u0022 data-doi=\u002210.1083\/jcb.122.4.809\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EErvasti\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. M.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECampbell\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. P.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1993\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EA role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Cell Biol.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E122\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E809\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E823\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1083\/jcb.122.4.809\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DThe%2BJournal%2Bof%2BCell%2BBiology%26rft.stitle%253DJCB%26rft.aulast%253DErvasti%26rft.auinit1%253DJ.%2BM.%26rft.volume%253D122%26rft.issue%253D4%26rft.spage%253D809%26rft.epage%253D823%26rft.atitle%253DA%2Brole%2Bfor%2Bthe%2Bdystrophin-glycoprotein%2Bcomplex%2Bas%2Ba%2Btransmembrane%2Blinker%2Bbetween%2Blaminin%2Band%2Bactin%26rft_id%253Dinfo%253Adoi%252F10.1083%252Fjcb.122.4.809%26rft_id%253Dinfo%253Apmid%252F8349731%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MzoiamNiIjtzOjU6InJlc2lkIjtzOjk6IjEyMi80LzgwOSI7czo0OiJhdG9tIjtzOjI0OiIvZG1tLzEzLzIvZG1tMDQwODMyLmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-16-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-16\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.16\u0022 data-doi=\u002210.1161\/01.HYP.30.3.383\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EFlesch\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESchiffer\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EZolk\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EO.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPinto\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ERosenkranz\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHirth-Dietrich\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EArnold\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPaul\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EB\u00f6hm\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1997\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EContractile systolic and diastolic dysfunction in renin-induced hypertensive cardiomyopathy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EHypertension\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E30\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E383\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E391\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1161\/01.HYP.30.3.383\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DHypertension%26rft.volume%253D30%26rft.spage%253D383%26rft_id%253Dinfo%253Adoi%252F10.1161%252F01.HYP.30.3.383%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1161\/01.HYP.30.3.383\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-17-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-17\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.17\u0022 data-doi=\u002210.1172\/JCI82768\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGao\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EQ. Q.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWyatt\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGoldstein\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELoPresti\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EP.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECastillo\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGazda\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPetrossian\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EN.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEarley\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. U.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHadhazy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBarefield\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. Y.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2015\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EReengineering a transmembrane protein to treat muscular dystrophy using exon skipping\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Clin. Invest.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E125\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E4186\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E4195\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1172\/JCI82768\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJ.%2BClin.%2BInvest.%26rft.volume%253D125%26rft.spage%253D4186%26rft_id%253Dinfo%253Adoi%252F10.1172%252FJCI82768%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1172\/JCI82768\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-18-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-18\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.18\u0022 data-doi=\u002210.1002\/emmm.201202168\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGedicke-Hornung\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBehrens-Gawlik\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EV.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EReischmann\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGeertz\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EB.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EStimpel\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWeinberger\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESchlossarek\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPr\u00e9cigout\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBraren\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EI.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEschenhagen\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2013\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003ERescue of cardiomyopathy through U7snRNA-mediated exon skipping in Mybpc3-targeted knock-in mice\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EEMBO Mol. Med.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E5\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1128\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E1145\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1002\/emmm.201202168\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DEMBO%2BMol.%2BMed.%26rft_id%253Dinfo%253Adoi%252F10.1002%252Femmm.201202168%26rft_id%253Dinfo%253Apmid%252F23716398%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NjoiZW1ib21tIjtzOjU6InJlc2lkIjtzOjg6IjUvNy8xMTI4IjtzOjQ6ImF0b20iO3M6MjQ6Ii9kbW0vMTMvMi9kbW0wNDA4MzIuYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-19-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-19\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.19\u0022 data-doi=\u002210.1038\/nm.3765\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGoyenvalle\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGriffith\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBabbs\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEl Andaloussi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEzzat\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAvril\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDugovic\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EB.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EChaussenot\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EFerry\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVoit\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2015\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EFunctional correction in mouse models of muscular dystrophy using exon-skipping tricyclo-DNA oligomers\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENat. Med.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E21\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E270\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E275\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1038\/nm.3765\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNat.%2BMed.%26rft.volume%253D21%26rft.spage%253D270%26rft_id%253Dinfo%253Adoi%252F10.1038%252Fnm.3765%26rft_id%253Dinfo%253Apmid%252F25642938%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1038\/nm.3765\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=25642938\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-20-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-20\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.20\u0022 data-doi=\u002210.15252\/emmm.201505047\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGramlich\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPane\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. S.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EZhou\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EQ.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EChen\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EZ.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMurgia\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESch\u00f6tterl\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGoedel\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMetzger\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBrade\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EParrotta\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2015\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EAntisense-mediated exon skipping: a therapeutic strategy for titin-based dilated cardiomyopathy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EEMBO Mol. Med.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E7\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E562\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E576\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.15252\/emmm.201505047\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DEMBO%2BMol.%2BMed.%26rft_id%253Dinfo%253Adoi%252F10.15252%252Femmm.201505047%26rft_id%253Dinfo%253Apmid%252F25759365%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NjoiZW1ib21tIjtzOjU6InJlc2lkIjtzOjc6IjcvNS81NjIiO3M6NDoiYXRvbSI7czoyNDoiL2RtbS8xMy8yL2RtbTA0MDgzMi5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-21-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-21\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.21\u0022 data-doi=\u002210.1083\/jcb.142.5.1279\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHack\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. T.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EJiang\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EClendenin\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. J.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESigrist\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. S.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWollmann\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER. L.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1998\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EGamma-sarcoglycan deficiency leads to muscle membrane defects and apoptosis independent of dystrophin\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Cell Biol.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E142\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1279\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E1287\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1083\/jcb.142.5.1279\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJ.%2BCell%2BBiol.%26rft_id%253Dinfo%253Adoi%252F10.1083%252Fjcb.142.5.1279%26rft_id%253Dinfo%253Apmid%252F9732288%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MzoiamNiIjtzOjU6InJlc2lkIjtzOjEwOiIxNDIvNS8xMjc5IjtzOjQ6ImF0b20iO3M6MjQ6Ii9kbW0vMTMvMi9kbW0wNDA4MzIuYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-22-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-22\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.22\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHack\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELam\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. Y.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECordier\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EShoturma\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. I.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. T.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHadhazy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHadhazy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESweeney\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH. L.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2000\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EDifferential requirement for individual sarcoglycans and dystrophin in the assembly and function of the dystrophin-glycoprotein complex\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Cell Sci.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E113\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E2535\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E2544\u003C\/span\u003E.\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJournal%2Bof%2BCell%2BScience%26rft.stitle%253DJ.%2BCell%2BSci.%26rft.aulast%253DHack%26rft.auinit1%253DA.%2BA.%26rft.volume%253D113%26rft.issue%253D14%26rft.spage%253D2535%26rft.epage%253D2544%26rft.atitle%253DDifferential%2Brequirement%2Bfor%2Bindividual%2Bsarcoglycans%2Band%2Bdystrophin%2Bin%2Bthe%2Bassembly%2Band%2Bfunction%2Bof%2Bthe%2Bdystrophin-glycoprotein%2Bcomplex%26rft_id%253Dinfo%253Apmid%252F10862711%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NToiam9jZXMiO3M6NToicmVzaWQiO3M6MTE6IjExMy8xNC8yNTM1IjtzOjQ6ImF0b20iO3M6MjQ6Ii9kbW0vMTMvMi9kbW0wNDA4MzIuYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-23-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-23\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.23\u0022 data-doi=\u002210.1016\/j.nmd.2005.05.004\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHeydemann\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHuber\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDemonbreun\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHadhazy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2005\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EGenetic background influences muscular dystrophy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENeuromuscul. Disord.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E15\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E601\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E609\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/j.nmd.2005.05.004\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNeuromuscular%2Bdisorders%2B%253A%2B%2BNMD%26rft.stitle%253DNeuromuscul%2BDisord%26rft.aulast%253DHeydemann%26rft.auinit1%253DA.%26rft.volume%253D15%26rft.issue%253D9-10%26rft.spage%253D601%26rft.epage%253D609%26rft.atitle%253DGenetic%2Bbackground%2Binfluences%2Bmuscular%2Bdystrophy.%26rft_id%253Dinfo%253Adoi%252F10.1016%252Fj.nmd.2005.05.004%26rft_id%253Dinfo%253Apmid%252F16084087%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/j.nmd.2005.05.004\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=16084087\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000232221900004\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-24-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-24\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.24\u0022 data-doi=\u002210.1172\/JCI39845\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHeydemann\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECeco\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELim\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. E.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHadhazy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ERyder\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EP.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMoran\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. L.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBeier\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPalmer\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. A.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2009\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003ELatent TGF-beta-binding protein 4 modifies muscular dystrophy in mice\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Clin. Invest.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E119\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E3703\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E3712\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1172\/JCI39845\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJournal%2Bof%2BClinical%2BInvestigation%26rft.stitle%253DJCI%26rft.aulast%253DHeydemann%26rft.auinit1%253DA.%26rft.volume%253D119%26rft.issue%253D12%26rft.spage%253D3703%26rft.epage%253D3712%26rft.atitle%253DLatent%2BTGF-beta-binding%2Bprotein%2B4%2Bmodifies%2Bmuscular%2Bdystrophy%2Bin%2Bmice.%26rft_id%253Dinfo%253Adoi%252F10.1172%252FJCI39845%26rft_id%253Dinfo%253Apmid%252F19884661%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1172\/JCI39845\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=19884661\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000272386400019\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-25-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-25\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.25\u0022 data-doi=\u002210.1016\/0092-8674(87)90579-4\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHoffman\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. P.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBrown\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER. H.\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-suffix\u0022\u003EJr.\u003C\/span\u003E.\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKunkel\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1987\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EDystrophin: the protein product of the Duchenne muscular dystrophy locus\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ECell\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E51\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E919\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E928\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/0092-8674(87)90579-4\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DCell%26rft.stitle%253DCell%26rft.aulast%253DHoffman%26rft.auinit1%253DE.%2BP.%26rft.volume%253D51%26rft.issue%253D6%26rft.spage%253D919%26rft.epage%253D928%26rft.atitle%253DDystrophin%253A%2Bthe%2Bprotein%2Bproduct%2Bof%2Bthe%2BDuchenne%2Bmuscular%2Bdystrophy%2Blocus.%26rft_id%253Dinfo%253Adoi%252F10.1016%252F0092-8674%252887%252990579-4%26rft_id%253Dinfo%253Apmid%252F3319190%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/0092-8674(87)90579-4\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=3319190\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=A1987L491900007\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-26-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-26\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.26\u0022 data-doi=\u002210.1002\/humu.22931\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EIgreja\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EClarke\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBotelho\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMarques\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAmaral\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. D.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2016\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003ECorrection of a cystic fibrosis splicing mutation by antisense oligonucleotides\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EHum. Mutat.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E37\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E209\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E215\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1002\/humu.22931\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DHum.%2BMutat.%26rft.volume%253D37%26rft.spage%253D209%26rft_id%253Dinfo%253Adoi%252F10.1002%252Fhumu.22931%26rft_id%253Dinfo%253Apmid%252F26553470%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1002\/humu.22931\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=26553470\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-27-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-27\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.27\u0022 data-doi=\u002210.1038\/nbt.3948\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EIwamoto\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EN.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EButler\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. C. D.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESvrzikapa\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EN.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMohapatra\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EZlatev\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EI.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESah\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. W. Y.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMeena\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EStandley\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELu\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EApponi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. H.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2017\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EControl of phosphorothioate stereochemistry substantially increases the efficacy of antisense oligonucleotides\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENat. Biotechnol.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E35\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E845\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E851\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1038\/nbt.3948\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNat.%2BBiotechnol.%26rft.volume%253D35%26rft.spage%253D845%26rft_id%253Dinfo%253Adoi%252F10.1038%252Fnbt.3948%26rft_id%253Dinfo%253Apmid%252F28829437%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1038\/nbt.3948\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=28829437\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-28-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-28\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.28\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKoenig\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBeggs\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. H.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMoyer\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EScherpf\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHeindrich\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBettecken\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMeng\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMuller\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELindlof\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKaariainen\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1989\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EThe molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EAm. J. Hum. Genet.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E45\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E498\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E506\u003C\/span\u003E.\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DAmerican%2Bjournal%2Bof%2Bhuman%2Bgenetics%26rft.stitle%253DAm%2BJ%2BHum%2BGenet%26rft.aulast%253DKoenig%26rft.auinit1%253DM.%26rft.volume%253D45%26rft.issue%253D4%26rft.spage%253D498%26rft.epage%253D506%26rft.atitle%253DThe%2Bmolecular%2Bbasis%2Bfor%2BDuchenne%2Bversus%2BBecker%2Bmuscular%2Bdystrophy%253A%2Bcorrelation%2Bof%2Bseverity%2Bwith%2Btype%2Bof%2Bdeletion.%26rft_id%253Dinfo%253Apmid%252F2491009%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=2491009\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=A1989AW39500003\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-29-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-29\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.29\u0022 data-doi=\u002210.1038\/nrd3625\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKole\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKrainer\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. R.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAltman\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2012\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003ERNA therapeutics: beyond RNA interference and antisense oligonucleotides\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENat. Rev. Drug Discov.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E11\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E125\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E140\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1038\/nrd3625\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNature%2Breviews.%2BDrug%2Bdiscovery%26rft.stitle%253DNat%2BRev%2BDrug%2BDiscov%26rft.aulast%253DKole%26rft.auinit1%253DR.%26rft.volume%253D11%26rft.issue%253D2%26rft.spage%253D125%26rft.epage%253D140%26rft.atitle%253DRNA%2Btherapeutics%253A%2Bbeyond%2BRNA%2Binterference%2Band%2Bantisense%2Boligonucleotides.%26rft_id%253Dinfo%253Adoi%252F10.1038%252Fnrd3625%26rft_id%253Dinfo%253Apmid%252F22262036%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1038\/nrd3625\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=22262036\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-30-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-30\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.30\u0022 data-doi=\u002210.1016\/j.ymthe.2018.10.011\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELim\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. R. Q.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEchigoya\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENagata\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKuraoka\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKobayashi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAoki\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPartridge\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMaruyama\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ETakeda\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EYokota\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2019\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EEfficacy of multi-exon skipping treatment in duchenne muscular dystrophy dog model neonates\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EMol. Ther.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E27\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E76\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E86\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/j.ymthe.2018.10.011\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DMol.%2BTher.%26rft.volume%253D27%26rft.spage%253D76%26rft_id%253Dinfo%253Adoi%252F10.1016%252Fj.ymthe.2018.10.011%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/j.ymthe.2018.10.011\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-31-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-31\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.31\u0022 data-doi=\u002210.1093\/jb\/118.5.959\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMatsuda\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENishikawa\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ETanaka\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1995\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EVisualization of dystrophic muscle fibers in mdx mouse by vital staining with Evans blue: evidence of apoptosis in dystrophin-deficient muscle\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Biochem.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E118\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E959\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E964\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1093\/jb\/118.5.959\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJ.%2BBiochem.%26rft_id%253Dinfo%253Adoi%252F10.1093%252Fjb%252F118.5.959%26rft_id%253Dinfo%253Apmid%252F8749313%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1093\/jb\/118.5.959\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=8749313\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=A1995TD03500014\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-32-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-32\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.32\u0022 data-doi=\u002210.1038\/359320a0\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMatsumura\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ETom\u00e9\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF. M. S.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECollin\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAzibi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EChaouch\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKaplan\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ.-C.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EFardeau\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECampbell\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. P.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1992\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EDeficiency of the 50K dystrophin-associated glycoprotein in severe childhood autosomal recessive muscular dystrophy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENature\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E359\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E320\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E322\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1038\/359320a0\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNature%26rft.stitle%253DNature%26rft.aulast%253DMatsumura%26rft.auinit1%253DK.%26rft.volume%253D359%26rft.issue%253D6393%26rft.spage%253D320%26rft.epage%253D322%26rft.atitle%253DDeficiency%2Bof%2Bthe%2B50K%2Bdystrophin-associated%2Bglycoprotein%2Bin%2Bsevere%2Bchildhood%2Bautosomal%2Brecessive%2Bmuscular%2Bdystrophy.%26rft_id%253Dinfo%253Adoi%252F10.1038%252F359320a0%26rft_id%253Dinfo%253Apmid%252F1406935%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1038\/359320a0\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=1406935\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-33-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-33\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.33\u0022 data-doi=\u002210.1093\/hmg\/5.11.1841\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDuggan\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGorospe\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBonnemann\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. G.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EFanin\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPegoraro\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELidov\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH. G.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENoguchi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EOzawa\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EFinkel\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER. S.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1996a\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EMutations that disrupt the carboxyl-terminus of gamma-sarcoglycan cause muscular dystrophy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EHum. Mol. Genet.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E5\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1841\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E1847\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1093\/hmg\/5.11.1841\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DHum.%2BMol.%2BGenet.%26rft_id%253Dinfo%253Adoi%252F10.1093%252Fhmg%252F5.11.1841%26rft_id%253Dinfo%253Apmid%252F8923014%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1093\/hmg\/5.11.1841\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=8923014\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=A1996VR15800019\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-34-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-34\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.34\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPassos-Bueno\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBonnemann\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. G.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVainzof\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003Ede Sa Moreira\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELidov\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH. G.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EOthmane\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. B.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDenton\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EP. H.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVance\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EZatz\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1996b\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EMild and severe muscular dystrophy caused by a single gamma-sarcoglycan mutation\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EAm. J. Hum. Genet.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E59\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E1040\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E1047\u003C\/span\u003E.\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DAmerican%2Bjournal%2Bof%2Bhuman%2Bgenetics%26rft.stitle%253DAm%2BJ%2BHum%2BGenet%26rft.aulast%253DMcNally%26rft.auinit1%253DE.%2BM.%26rft.volume%253D59%26rft.issue%253D5%26rft.spage%253D1040%26rft.epage%253D1047%26rft.atitle%253DMild%2Band%2Bsevere%2Bmuscular%2Bdystrophy%2Bcaused%2Bby%2Ba%2Bsingle%2Bgamma-sarcoglycan%2Bmutation.%26rft_id%253Dinfo%253Apmid%252F8900232%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=8900232\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=A1996VN90000011\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-35-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-35\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.35\u0022 data-doi=\u002210.1016\/0888-7543(88)90113-9\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMonaco\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. P.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBertelson\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. J.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELiechti-Gallati\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMoser\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKunkel\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1988\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EAn explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EGenomics\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E2\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E90\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E95\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/0888-7543(88)90113-9\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DGenomics%26rft.stitle%253DGenomics%26rft.aulast%253DMonaco%26rft.auinit1%253DA.%2BP.%26rft.volume%253D2%26rft.issue%253D1%26rft.spage%253D90%26rft.epage%253D95%26rft.atitle%253DAn%2Bexplanation%2Bfor%2Bthe%2Bphenotypic%2Bdifferences%2Bbetween%2Bpatients%2Bbearing%2Bpartial%2Bdeletions%2Bof%2Bthe%2BDMD%2Blocus.%26rft_id%253Dinfo%253Adoi%252F10.1016%252F0888-7543%252888%252990113-9%26rft_id%253Dinfo%253Apmid%252F3384440%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/0888-7543(88)90113-9\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=3384440\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000208529200012\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-36-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-36\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.36\u0022 data-doi=\u002210.2144\/000113005\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMorcos\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EP. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ELi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EJiang\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2008\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EVivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EBioTechniques\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E45\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E613\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E614\u003C\/span\u003E, \u003Cspan class=\u0022cit-comment\u0022\u003E616, 618 passim\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.2144\/000113005\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DBioTechniques%26rft.volume%253D45%26rft.spage%253D613%26rft_id%253Dinfo%253Adoi%252F10.2144%252F000113005%26rft_id%253Dinfo%253Apmid%252F19238792%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.2144\/000113005\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=19238792\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000263637100001\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-37-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-37\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.37\u0022 data-doi=\u002210.1126\/science.270.5237.819\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENoguchi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBen Othmane\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHagiwara\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMizuno\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EYoshida\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EYamamoto\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBonnemann\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. G.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGussoni\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDenton\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EP. H.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1995\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EMutations in the dystrophin-associated protein gamma-sarcoglycan in chromosome 13 muscular dystrophy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EScience\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E270\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E819\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E822\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1126\/science.270.5237.819\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DScience%26rft.stitle%253DScience%26rft.aulast%253DNoguchi%26rft.auinit1%253DS.%26rft.volume%253D270%26rft.issue%253D5237%26rft.spage%253D819%26rft.epage%253D822%26rft.atitle%253DMutations%2Bin%2Bthe%2BDystrophin-Associated%2BProtein%2B%255BIMAGE%255D-Sarcoglycan%2Bin%2BChromosome%2B13%2BMuscular%2BDystrophy%26rft_id%253Dinfo%253Adoi%252F10.1126%252Fscience.270.5237.819%26rft_id%253Dinfo%253Apmid%252F7481775%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Mzoic2NpIjtzOjU6InJlc2lkIjtzOjEyOiIyNzAvNTIzNy84MTkiO3M6NDoiYXRvbSI7czoyNDoiL2RtbS8xMy8yL2RtbTA0MDgzMi5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-38-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-38\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.38\u0022 data-doi=\u002210.1172\/JCI91445\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EQuattrocelli\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBarefield\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. Y.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWarner\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. L.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVo\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. H.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHadhazy\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEarley\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. U.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDemonbreun\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. R.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2017a\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EIntermittent glucocorticoid steroid dosing enhances muscle repair without eliciting muscle atrophy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Clin. Invest.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E127\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E2418\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E2432\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1172\/JCI91445\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJ.%2BClin.%2BInvest.%26rft.volume%253D127%26rft.spage%253D2418%26rft_id%253Dinfo%253Adoi%252F10.1172%252FJCI91445%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1172\/JCI91445\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-39-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-39\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.39\u0022 data-doi=\u002210.1016\/j.ajpath.2017.07.017\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EQuattrocelli\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESalamone\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EI. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPage\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EP. G.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWarner\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. L.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDemonbreun\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. R.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcNally\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2017b\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EIntermittent glucocorticoid dosing improves muscle repair and function in mice with limb-girdle muscular dystrophy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EAm. J. Pathol.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E187\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E2520\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E2535\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/j.ajpath.2017.07.017\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DAm.%2BJ.%2BPathol.%26rft.volume%253D187%26rft.spage%253D2520%26rft_id%253Dinfo%253Adoi%252F10.1016%252Fj.ajpath.2017.07.017%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/j.ajpath.2017.07.017\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-40-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-40\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.40\u0022 data-doi=\u002210.1083\/jcb.201212142\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ERahimov\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKunkel\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2013\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EThe cell biology of disease: cellular and molecular mechanisms underlying muscular dystrophy\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJ. Cell Biol.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E201\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E499\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E510\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1083\/jcb.201212142\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJ.%2BCell%2BBiol.%26rft_id%253Dinfo%253Adoi%252F10.1083%252Fjcb.201212142%26rft_id%253Dinfo%253Apmid%252F23671309%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MzoiamNiIjtzOjU6InJlc2lkIjtzOjk6IjIwMS80LzQ5OSI7czo0OiJhdG9tIjtzOjI0OiIvZG1tLzEzLzIvZG1tMDQwODMyLmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-41-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-41\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.41\u0022 data-doi=\u002210.1016\/s0960-8966(02)00220-1\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESasaoka\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EImamura\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EAraishi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENoguchi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ES.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMizuno\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ETakagoshi\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EN.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHama\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWakabayashi-Takai\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EYoshimoto-Matsuda\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EY.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ENonaka\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EI.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2003\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EPathological analysis of muscle hypertrophy and degeneration in muscular dystrophy in gamma-sarcoglycan-deficient mice\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENeuromuscul. Disord.\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E13\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E193\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E206\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/s0960-8966(02)00220-1\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DNeuromuscular%2Bdisorders%2B%253A%2B%2BNMD%26rft.stitle%253DNeuromuscul%2BDisord%26rft.aulast%253DSasaoka%26rft.auinit1%253DT.%26rft.volume%253D13%26rft.issue%253D3%26rft.spage%253D193%26rft.epage%253D206%26rft.atitle%253DPathological%2Banalysis%2Bof%2Bmuscle%2Bhypertrophy%2Band%2Bdegeneration%2Bin%2Bmuscular%2Bdystrophy%2Bin%2Bgamma-sarcoglycan-deficient%2Bmice.%26rft_id%253Dinfo%253Adoi%252F10.1016%252Fs0960-8966%252802%252900220-1%26rft_id%253Dinfo%253Apmid%252F12609501%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/s0960-8966(02)00220-1\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=12609501\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000181746700001\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-42-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-42\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.42\u0022 data-doi=\u002210.1002\/mus.24998\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESmith\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHammers\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. W.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESweeney\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH. L.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBarton\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. R.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2016\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EIncreased collagen cross-linking is a signature of dystrophin-deficient muscle\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EMuscle Nerve\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E54\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E71\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E78\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1002\/mus.24998\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DMuscle%2BNerve%26rft.volume%253D54%26rft.spage%253D71%26rft_id%253Dinfo%253Adoi%252F10.1002%252Fmus.24998%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1002\/mus.24998\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-43-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-43\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.43\u0022 data-doi=\u002210.1016\/j.nurt.2008.08.003\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EStraub\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EV.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EBushby\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2008\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003ETherapeutic possibilities in the autosomal recessive limb-girdle muscular dystrophies\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ENeurotherapeutics\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E5\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E619\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E626\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/j.nurt.2008.08.003\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.stitle%253DNeurotherapeutics%26rft.aulast%253DStraub%26rft.auinit1%253DV.%26rft.volume%253D5%26rft.issue%253D4%26rft.spage%253D619%26rft.epage%253D626%26rft.atitle%253DTherapeutic%2Bpossibilities%2Bin%2Bthe%2Bautosomal%2Brecessive%2Blimb-girdle%2Bmuscular%2Bdystrophies.%26rft_id%253Dinfo%253Adoi%252F10.1016%252Fj.nurt.2008.08.003%26rft_id%253Dinfo%253Apmid%252F19019315%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/j.nurt.2008.08.003\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=19019315\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000259727800017\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-44-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-44\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.44\u0022 data-doi=\u002210.1073\/pnas.1324242111\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESwaggart\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. A.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDemonbreun\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVo\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. H.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESwanson\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK. E.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKim\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. Y.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EFahrenbach\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ. P.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EHolley-Cuthrell\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EEskin\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EChen\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EZ.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESquire\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2014\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EAnnexin A6 modifies muscular dystrophy by mediating sarcolemmal repair\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EProc. Natl. Acad. Sci. USA\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E111\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E6004\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E6009\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1073\/pnas.1324242111\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DProc.%2BNatl.%2BAcad.%2BSci.%2BUSA%26rft_id%253Dinfo%253Adoi%252F10.1073%252Fpnas.1324242111%26rft_id%253Dinfo%253Apmid%252F24717843%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NDoicG5hcyI7czo1OiJyZXNpZCI7czoxMToiMTExLzE2LzYwMDQiO3M6NDoiYXRvbSI7czoyNDoiL2RtbS8xMy8yL2RtbTA0MDgzMi5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-45-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-45\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.45\u0022 data-doi=\u002210.1126\/science.286.5449.2511\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EThurston\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESuri\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESmith\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EK.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcClain\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EJ.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ESato\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ET. N.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EYancopoulos\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EG. D.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EMcDonald\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ED. M.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E1999\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003ELeakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EScience\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E286\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E2511\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E2514\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1126\/science.286.5449.2511\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DScience%26rft.stitle%253DScience%26rft.aulast%253DThurston%26rft.auinit1%253DG.%26rft.volume%253D286%26rft.issue%253D5449%26rft.spage%253D2511%26rft.epage%253D2514%26rft.atitle%253DLeakage-Resistant%2BBlood%2BVessels%2Bin%2BMice%2BTransgenically%2BOverexpressing%2BAngiopoietin-1%26rft_id%253Dinfo%253Adoi%252F10.1126%252Fscience.286.5449.2511%26rft_id%253Dinfo%253Apmid%252F10617467%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/ijlink\/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Mzoic2NpIjtzOjU6InJlc2lkIjtzOjEzOiIyODYvNTQ0OS8yNTExIjtzOjQ6ImF0b20iO3M6MjQ6Ii9kbW0vMTMvMi9kbW0wNDA4MzIuYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-ijlink\u0022\u003E\u003Cspan\u003E\u003Cspan class=\u0022cit-reflinks-abstract\u0022\u003EAbstract\u003C\/span\u003E\u003Cspan class=\u0022cit-sep cit-reflinks-variant-name-sep\u0022\u003E\/\u003C\/span\u003E\u003Cspan class=\u0022cit-reflinks-full-text\u0022\u003E\u003Cspan class=\u0022free-full-text\u0022\u003EFREE \u003C\/span\u003EFull Text\u003C\/span\u003E\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-46-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-46\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.46\u0022 data-doi=\u002210.1016\/j.cell.2013.04.025\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWang\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EYang\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EH.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EShivalila\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EC. S.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDawlaty\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003ECheng\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. W.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EZhang\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EF.\u003C\/span\u003E\u003C\/span\u003E and \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EJaenisch\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER.\u003C\/span\u003E\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2013\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EOne-step generation of mice carrying mutations in multiple genes by CRISPR\/Cas-mediated genome engineering\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003ECell\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E153\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E910\u003C\/span\u003E-\u003Cspan class=\u0022cit-lpage\u0022\u003E918\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1016\/j.cell.2013.04.025\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DCell%26rft.volume%253D153%26rft.spage%253D910%26rft_id%253Dinfo%253Adoi%252F10.1016%252Fj.cell.2013.04.025%26rft_id%253Dinfo%253Apmid%252F23643243%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1016\/j.cell.2013.04.025\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=23643243\u0026amp;link_type=MED\u0026amp;atom=%2Fdmm%2F13%2F2%2Fdmm040832.atom\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-medline\u0022\u003E\u003Cspan\u003EPubMed\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=000318844000018\u0026amp;link_type=ISI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-newisilink cit-ref-sprinkles-webofscience\u0022\u003E\u003Cspan\u003EWeb of Science\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022ref-label ref-label-empty\u0022\u003E\u003C\/span\u003E\u003Ca class=\u0022rev-xref-ref\u0022 href=\u0022#xref-ref-47-1\u0022 title=\u0022View reference in text\u0022 id=\u0022ref-47\u0022\u003E\u21b5\u003C\/a\u003E\u003Cdiv class=\u0022cit ref-cit ref-journal\u0022 id=\u0022cit-13.2.dmm040832.47\u0022 data-doi=\u002210.1172\/jci.insight.99357\u0022\u003E\u003Cdiv class=\u0022cit-metadata\u0022\u003E\u003Col class=\u0022cit-auth-list\u0022\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EWyatt\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. J.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDemonbreun\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. R.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EKim\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EE. Y.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPuckelwartz\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM. J.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVo\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EA. H.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EDellefave-Castillo\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EL. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EGao\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EQ. Q.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EVainzof\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EPavanello\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003ER. C. M.\u003C\/span\u003E\u003C\/span\u003E, \u003C\/li\u003E\u003Cli\u003E\u003Cspan class=\u0022cit-auth\u0022\u003E\u003Cspan class=\u0022cit-name-surname\u0022\u003EZatz\u003C\/span\u003E, \u003Cspan class=\u0022cit-name-given-names\u0022\u003EM.\u003C\/span\u003E\u003C\/span\u003E \u003Cspan class=\u0022cit-etal\u0022\u003Eet al.\u003C\/span\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003Ccite\u003E (\u003Cspan class=\u0022cit-pub-date\u0022\u003E2018\u003C\/span\u003E). \u003Cspan class=\u0022cit-article-title\u0022\u003EEfficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers\u003C\/span\u003E. \u003Cabbr class=\u0022cit-jnl-abbrev\u0022\u003EJCI Insight\u003C\/abbr\u003E \u003Cspan class=\u0022cit-vol\u0022\u003E3\u003C\/span\u003E, \u003Cspan class=\u0022cit-fpage\u0022\u003E99357\u003C\/span\u003E.\u003Cspan class=\u0022cit-pub-id-sep cit-pub-id-doi-sep\u0022\u003E \u003C\/span\u003E\u003Cspan class=\u0022cit-pub-id cit-pub-id-doi\u0022\u003E\u003Cspan class=\u0022cit-pub-id-scheme-doi\u0022\u003Edoi:\u003C\/span\u003E10.1172\/jci.insight.99357\u003C\/span\u003E\u003C\/cite\u003E\u003C\/div\u003E\u003Cdiv class=\u0022cit-extra\u0022\u003E\u003Ca href=\u0022{openurl}?query=rft.jtitle%253DJCI%2BInsight%26rft.volume%253D3%26rft.spage%253D99357%26rft_id%253Dinfo%253Adoi%252F10.1172%252Fjci.insight.99357%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-openurl cit-ref-sprinkles-open-url\u0022\u003E\u003Cspan\u003EOpenUrl\u003C\/span\u003E\u003C\/a\u003E\u003Ca href=\u0022\/lookup\/external-ref?access_num=10.1172\/jci.insight.99357\u0026amp;link_type=DOI\u0022 class=\u0022cit-ref-sprinkles cit-ref-sprinkles-doi cit-ref-sprinkles-crossref\u0022\u003E\u003Cspan\u003ECrossRef\u003C\/span\u003E\u003C\/a\u003E\u003C\/div\u003E\u003C\/div\u003E\u003C\/li\u003E\u003C\/ol\u003E\u003C\/div\u003E\u003Cspan class=\u0022highwire-journal-article-marker-end\u0022\u003E\u003C\/span\u003E\u003C\/div\u003E\u003Cspan id=\u0022related-urls\u0022\u003E\u003C\/span\u003E\u003C\/div\u003E\u003Ca href=\u0022https:\/\/www.stormoverpacific.com\/content\/13\/2\/dmm040832.abstract\u0022 class=\u0022hw-link hw-link-article-abstract\u0022 data-icon-position=\u0022\u0022 data-hide-link-title=\u00220\u0022\u003EView Abstract\u003C\/a\u003E\u003C\/div\u003E \u003C\/div\u003E\n\n \n \u003C\/div\u003E\n\u003Cdiv class=\u0022panel-separator\u0022\u003E\u003C\/div\u003E\u003Cdiv class=\u0022panel-pane pane-highwire-article-trendmd\u0022 \u003E\n \n \n \n \u003Cdiv class=\u0022pane-content\u0022\u003E\n \u003Cdiv id=\u0022trendmd-suggestions\u0022\u003E\u003C\/div\u003E \u003C\/div\u003E\n\n \n \u003C\/div\u003E\n\u003C\/div\u003E\n \u003C\/div\u003E\n\u003C\/div\u003E\n\u003C\/div\u003E\u003Cscript type=\u0022text\/javascript\u0022 src=\u0022https:\/\/www.stormoverpacific.com\/sites\/default\/files\/js\/js_nTx2uViKwvT5B3q2ThNg2qa8q0fOz3_UCRnKM5DnE8Q.js\u0022\u003E\u003C\/script\u003E\n\u003C\/body\u003E\u003C\/html\u003E"}Ļ